Labshake search
Citations for Avidity :
1 - 9 of 9 citations for 7 AMINONAPHTHALENE 1 3 DISULFONIC ACID POTASSIUM SALT since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... in-frame with the 3’Avitag (Avidity) sequence GGTCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAA ...
-
bioRxiv - Immunology 2021Quote: ... AviTagged Y2 COBRA HA proteins containing the Y98F mutation to reduce sialic acid binding were biotinylated using the BirA biotin-protein ligase in the BirA500 kit (Avidity) and complexed to streptavidin-fluorophores SA-PE (1:500 dilution ...
-
bioRxiv - Immunology 2023Quote: ... HAPR8 tetramers for flow cytometry were generated by site-specific biotinylation of non-cysteine-stabilized treated HA protein containing the Y98F mutation that prevents sialic acid binding using BirA-500 ligase (Avidity), followed by Zeba desalting column purification (Thermo Fisher) ...
-
bioRxiv - Immunology 2023Quote: ... HLA-I/peptide tetramer staining solution was prepared by mixing all tetramers into a solution of 1:1 FACS buffer and Brilliant Buffer containing 0.2% milk and 5μM free D-biotin (Avidity LLC) immediately prior to staining ...
-
bioRxiv - Neuroscience 2023Quote: The amino terminal domain of GluA1 (1-394 a.a.) fused to a biotin acceptor tag (AviTag, Avidity) grown in suspension cultures of Sf9 cells was used as a target for the mRNA display selection ...
-
bioRxiv - Immunology 2022Quote: Purified and Avi-tagged SARS-CoV-2 Wuhan-Hu-1 RBD was biotinylated using the Biotin-Protein Ligase-BIRA kit according to manufacturer’s instructions (Avidity) as described before18 ...
-
bioRxiv - Immunology 2022Quote: Purified and Avi-tagged SARS-CoV-2 Wuhan-Hu-1 RBD and NTD were biotinylated using the Biotin-Protein Ligase-BIRA kit according to manufacturer’s instructions (Avidity) as described before (11) ...
-
bioRxiv - Immunology 2022Quote: ... the S-Avitag substrates were diluted to 40 μM and incubated for 1 h at 30℃ with 15 μg/mL BirA enzyme (Avidity) in 0.05 M bicine buffer at pH 8.3 supplemented with 10 mM ATP ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... On day 1 and 3 mice were placed into test cages which contained sawdust and a cardboard tube and were presented with a 1 % sucrose solution in two sipper sacks (Edstrom-Avidity Science) with drip-free drinking valves ...