Labshake search
Citations for Avidity :
1 - 3 of 3 citations for 7 3 methoxyphenyl 7 oxoheptanoic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... in-frame with the 3’Avitag (Avidity) sequence GGTCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAA ...
-
bioRxiv - Immunology 2021Quote: ... AviTagged Y2 COBRA HA proteins containing the Y98F mutation to reduce sialic acid binding were biotinylated using the BirA biotin-protein ligase in the BirA500 kit (Avidity) and complexed to streptavidin-fluorophores SA-PE (1:500 dilution ...
-
bioRxiv - Immunology 2023Quote: ... HAPR8 tetramers for flow cytometry were generated by site-specific biotinylation of non-cysteine-stabilized treated HA protein containing the Y98F mutation that prevents sialic acid binding using BirA-500 ligase (Avidity), followed by Zeba desalting column purification (Thermo Fisher) ...