Labshake search
Citations for Avidity :
1 - 3 of 3 citations for 6 Quinolinamine N N 3 trimethyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2021Quote: ... as hybrid proteins consisting of an N-terminal Ulp1-cleavable N-terminal His10-SUMO sequence followed by an AviTag sequence (Avidity, LCC, Aurora, Colorado, USA), facilitating in vivo biotinylation and four consecutive C-terminal Myc-tag sequences ...
-
bioRxiv - Biophysics 2022Quote: The GPIbα used for kinetic measurements contained an N-terminal Avi-tag which was biotinylated using a BirA biotin-protein ligase kit (Cat #BirA500, Avidity, Aurora, CO). Biolayer interferometry (BLI ...
-
bioRxiv - Molecular Biology 2021Quote: ... in-frame with the 3’Avitag (Avidity) sequence GGTCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAA ...