Labshake search
Citations for Avidity :
1 - 19 of 19 citations for 6 Methoxy 2 methyl 1H benz de isoquinoline 1 3 2H dione since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... in-frame with the 3’Avitag (Avidity) sequence GGTCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAA ...
-
bioRxiv - Immunology 2022Quote: Purified and Avi-tagged SARS-CoV-2 Wuhan-Hu-1 RBD was biotinylated using the Biotin-Protein Ligase-BIRA kit according to manufacturer’s instructions (Avidity) as described before18 ...
-
bioRxiv - Biophysics 2022Quote: ... pFN18a (Ig32)2-(R3IVVI)-(Ig32)2 was subcloned into a modified pFN18a vector engineered with the AviTagTM (Avidity) (sequence GLNDIFEAQKIEWHE) ...
-
bioRxiv - Immunology 2020Quote: ... we biotinylated SARS-CoV-2 RBD using a terminal AviTag and BirA biotin ligase (Avidity) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... The avi-tagged SARS-CoV-2 RBD antigen was first labeled with biotin (Avidity, BirA500) was subsequently coupled to streptavidin-PE and streptavidin-APC (BD Biosciences ...
-
bioRxiv - Immunology 2021Quote: ... the probes were generated by the biotinylation of Avi-tagged SARS-CoV-2 antigens using biotin ligase BirA according to the manufacturer’s instructions (Avidity). Biotin excess was removed by SEC on either a Superdex 200 10/300 column (GE Healthcare ...
-
bioRxiv - Immunology 2022Quote: Purified and Avi-tagged SARS-CoV-2 NTD was biotinylated using the Biotin-Protein Ligase-BIRA kit according to manufacturer’s instructions (Avidity) as described before (Robbiani et al. ...
-
bioRxiv - Immunology 2021Quote: Purified and Avi-tagged SARS-CoV-2 RBD was biotinylated using the Biotin-Protein Ligase-BIRA kit according to manufacturer’s instructions (Avidity) as described before 1 ...
-
bioRxiv - Immunology 2021Quote: ... The captured SARS-CoV-2 protein was then biotinylated using the BIRA500 kit (∼2.5 μg per 10 nmol AVI substrate) (Avidity) and cleaved from the Fc purification tag concurrently with 200 μg of HRV3C prepared as described [42] ...
-
bioRxiv - Immunology 2020Quote: Purified and Avi-tagged SARS-CoV-2 RBD was biotinylated using the Biotin-Protein Ligase-BIRA kit according to manufacturer’s instructions (Avidity). Ovalbumin (Sigma ...
-
bioRxiv - Immunology 2022Quote: Purified and Avi-tagged SARS-CoV-2 WT and Delta RBD was biotinylated using the Biotin-Protein Ligase-BIRA kit according to manufacturer’s instructions (Avidity) as described before(Robbiani et al. ...
-
bioRxiv - Immunology 2022Quote: ... Avi-tagged SARS-CoV-2 RBD and SD1-RBD (both corresponding to SARS-CoV-2 ancestral virus) were biotinylated using the Biotin-Protein Ligase-BIRA kit according to manufacturer’s instructions (Avidity). Ovalbumin (Sigma ...
-
bioRxiv - Immunology 2021Quote: ... spike protein probes were added one-by-one to FACS wash buffer (1x PBS, 2% fetal bovine serum) containing 5μM free d-biotin (Avidity, Cat. Bir500A). Both streptavidin-fluor conjugates were used to stain DMSO control samples to further verify the absence of significant frequencies of non-specific streptavidin-binding B cells.
-
bioRxiv - Immunology 2023Quote: ... competing antibody was diluted to a final concentration of 5 µg/mL in blocking buffer and added to 2 µg/mL GP that was biotinylated through a fused Avi-tag (Avidity, Aurora, Colorado) and incubated for one hour at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... HLA-I/peptide tetramer staining solution was prepared by mixing all tetramers into a solution of 1:1 FACS buffer and Brilliant Buffer containing 0.2% milk and 5μM free D-biotin (Avidity LLC) immediately prior to staining ...
-
bioRxiv - Neuroscience 2023Quote: The amino terminal domain of GluA1 (1-394 a.a.) fused to a biotin acceptor tag (AviTag, Avidity) grown in suspension cultures of Sf9 cells was used as a target for the mRNA display selection ...
-
bioRxiv - Immunology 2022Quote: Purified and Avi-tagged SARS-CoV-2 Wuhan-Hu-1 RBD and NTD were biotinylated using the Biotin-Protein Ligase-BIRA kit according to manufacturer’s instructions (Avidity) as described before (11) ...
-
bioRxiv - Immunology 2022Quote: ... the S-Avitag substrates were diluted to 40 μM and incubated for 1 h at 30℃ with 15 μg/mL BirA enzyme (Avidity) in 0.05 M bicine buffer at pH 8.3 supplemented with 10 mM ATP ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... On day 1 and 3 mice were placed into test cages which contained sawdust and a cardboard tube and were presented with a 1 % sucrose solution in two sipper sacks (Edstrom-Avidity Science) with drip-free drinking valves ...