Labshake search
Citations for Avidity :
1 - 12 of 12 citations for 6 Chloro 4 methyl 1 benzothiophen 3 ol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... in-frame with the 3’Avitag (Avidity) sequence GGTCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAA ...
-
bioRxiv - Immunology 2022Quote: ... complexes were biotinylated overnight at 4°C using biotin (Avidity), ATP ...
-
bioRxiv - Immunology 2024Quote: ... HLA-DR monomers were biotinylated overnight at 4°C using BirA biotin ligase (Avidity) and purified by size exclusion chromatography using Superdex 200 size exclusion column (AKTA ...
-
bioRxiv - Microbiology 2022Quote: ... Proteins were biotinylated overnight at 4°C using a BirA biotinprotein ligase reaction kit (Avidity) and re-purified using the same HisTrap HP affinity method described above before being flash frozen.
-
bioRxiv - Immunology 2022Quote: ... Secreted protein was purified using HisPur Ni-NTA resin (Thermo) for immobilized metal affinity chromatography (IMAC) and biotinylated overnight at 4°C using biotin (Avidity), ATP ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... rats were water restricted for a period of 4 h and were then placed in test cages containing two sipper sacks (Avidity Science) for 1 h ...
-
bioRxiv - Immunology 2023Quote: ... HLA-I/peptide tetramer staining solution was prepared by mixing all tetramers into a solution of 1:1 FACS buffer and Brilliant Buffer containing 0.2% milk and 5μM free D-biotin (Avidity LLC) immediately prior to staining ...
-
bioRxiv - Neuroscience 2023Quote: The amino terminal domain of GluA1 (1-394 a.a.) fused to a biotin acceptor tag (AviTag, Avidity) grown in suspension cultures of Sf9 cells was used as a target for the mRNA display selection ...
-
bioRxiv - Immunology 2022Quote: Purified and Avi-tagged SARS-CoV-2 Wuhan-Hu-1 RBD was biotinylated using the Biotin-Protein Ligase-BIRA kit according to manufacturer’s instructions (Avidity) as described before18 ...
-
bioRxiv - Immunology 2022Quote: Purified and Avi-tagged SARS-CoV-2 Wuhan-Hu-1 RBD and NTD were biotinylated using the Biotin-Protein Ligase-BIRA kit according to manufacturer’s instructions (Avidity) as described before (11) ...
-
bioRxiv - Immunology 2022Quote: ... the S-Avitag substrates were diluted to 40 μM and incubated for 1 h at 30℃ with 15 μg/mL BirA enzyme (Avidity) in 0.05 M bicine buffer at pH 8.3 supplemented with 10 mM ATP ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... On day 1 and 3 mice were placed into test cages which contained sawdust and a cardboard tube and were presented with a 1 % sucrose solution in two sipper sacks (Edstrom-Avidity Science) with drip-free drinking valves ...