Labshake search
Citations for Avidity :
1 - 6 of 6 citations for 6 Chloro 3 methyl 4 pyridinemethanol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... in-frame with the 3’Avitag (Avidity) sequence GGTCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAA ...
-
bioRxiv - Immunology 2022Quote: ... complexes were biotinylated overnight at 4°C using biotin (Avidity), ATP ...
-
bioRxiv - Immunology 2024Quote: ... HLA-DR monomers were biotinylated overnight at 4°C using BirA biotin ligase (Avidity) and purified by size exclusion chromatography using Superdex 200 size exclusion column (AKTA ...
-
bioRxiv - Microbiology 2022Quote: ... Proteins were biotinylated overnight at 4°C using a BirA biotinprotein ligase reaction kit (Avidity) and re-purified using the same HisTrap HP affinity method described above before being flash frozen.
-
bioRxiv - Immunology 2022Quote: ... Secreted protein was purified using HisPur Ni-NTA resin (Thermo) for immobilized metal affinity chromatography (IMAC) and biotinylated overnight at 4°C using biotin (Avidity), ATP ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... rats were water restricted for a period of 4 h and were then placed in test cages containing two sipper sacks (Avidity Science) for 1 h ...