Labshake search
Citations for Avidity :
1 - 13 of 13 citations for 6 CHLOROBENZO D ISOXAZOLE 3 CARBONITRILE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2019Quote: ... d-Biotin was purchased from Avidity, LLC (Aurora ...
-
bioRxiv - Cell Biology 2023Quote: ... and 50 μM d-biotin (Avidity) at 4°C overnight.
-
bioRxiv - Immunology 2021Quote: ... D-biotin (20 μM; Avidity; Cat no I2011) was added 24 h after multimerization ...
-
bioRxiv - Immunology 2020Quote: ... containing 5μM free d-biotin (Avidity, Cat# Bir500A). Free d-biotin ensured minimal cross-reactivity of antigen probes ...
-
bioRxiv - Bioengineering 2022Quote: ... and 10 μL of 5 mM D-biotin (Avidity) were added to the protein along with BirA ligase ...
-
bioRxiv - Molecular Biology 2021Quote: ... in-frame with the 3’Avitag (Avidity) sequence GGTCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAA ...
-
bioRxiv - Immunology 2022Quote: ... MHC multimers were diluted in PBS with 5.2 μM d-biotin (Avidity, Bio200) to 909 nM and incubated 20 min on ice ...
-
bioRxiv - Immunology 2022Quote: ... and HA were prepared individually and mixed together after multimerization with 5uM free D-biotin (Avidity LLC) to minimize potential cross-reactivity between probes ...
-
bioRxiv - Immunology 2021Quote: ... and HA were prepared individually and mixed together after multimerization with 5uM free D-biotin (Avidity LLC) to minimize potential cross-reactivity between probes ...
-
bioRxiv - Immunology 2023Quote: ... Antigen probes were prepared individually and mixed together after multimerization with 5μM free D-biotin (Avidity LLC) to minimize potential cross-reactivity between probes ...
-
bioRxiv - Immunology 2023Quote: ... HLA-I/peptide tetramer staining solution was prepared by mixing all tetramers into a solution of 1:1 FACS buffer and Brilliant Buffer containing 0.2% milk and 5μM free D-biotin (Avidity LLC) immediately prior to staining ...
-
bioRxiv - Immunology 2021Quote: ... spike protein probes were added one-by-one to FACS wash buffer (1x PBS, 2% fetal bovine serum) containing 5μM free d-biotin (Avidity, Cat. Bir500A). Both streptavidin-fluor conjugates were used to stain DMSO control samples to further verify the absence of significant frequencies of non-specific streptavidin-binding B cells.
-
bioRxiv - Biochemistry 2021Quote: ... 750 µg of purified uncleaved hSPAK-CCT or hOSR-CCT were mixed with 50 µl of SuperMix (containing ATP and D-biotin, Avidity, LLC) and 5 μg of BirA (Avidity ...