Labshake search
Citations for Avidity :
1 - 8 of 8 citations for 6 4 Methoxybenzylcarbamoyl pyridine 3 boronic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... in-frame with the 3’Avitag (Avidity) sequence GGTCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAA ...
-
bioRxiv - Immunology 2022Quote: ... complexes were biotinylated overnight at 4°C using biotin (Avidity), ATP ...
-
bioRxiv - Immunology 2021Quote: ... AviTagged Y2 COBRA HA proteins containing the Y98F mutation to reduce sialic acid binding were biotinylated using the BirA biotin-protein ligase in the BirA500 kit (Avidity) and complexed to streptavidin-fluorophores SA-PE (1:500 dilution ...
-
bioRxiv - Immunology 2023Quote: ... HAPR8 tetramers for flow cytometry were generated by site-specific biotinylation of non-cysteine-stabilized treated HA protein containing the Y98F mutation that prevents sialic acid binding using BirA-500 ligase (Avidity), followed by Zeba desalting column purification (Thermo Fisher) ...
-
bioRxiv - Immunology 2024Quote: ... HLA-DR monomers were biotinylated overnight at 4°C using BirA biotin ligase (Avidity) and purified by size exclusion chromatography using Superdex 200 size exclusion column (AKTA ...
-
bioRxiv - Microbiology 2022Quote: ... Proteins were biotinylated overnight at 4°C using a BirA biotinprotein ligase reaction kit (Avidity) and re-purified using the same HisTrap HP affinity method described above before being flash frozen.
-
bioRxiv - Immunology 2022Quote: ... Secreted protein was purified using HisPur Ni-NTA resin (Thermo) for immobilized metal affinity chromatography (IMAC) and biotinylated overnight at 4°C using biotin (Avidity), ATP ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... rats were water restricted for a period of 4 h and were then placed in test cages containing two sipper sacks (Avidity Science) for 1 h ...