Labshake search
Citations for Avidity :
1 - 6 of 6 citations for 5 Isoxazolemethanol 3 3 fluorophenyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... in-frame with the 3’Avitag (Avidity) sequence GGTCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAA ...
-
bioRxiv - Biochemistry 2021Quote: ... and 5 μg of BirA (Avidity, LLC), to a final volume of 500 μL buffer [20 mM Tris.HCl pH 7.8 ...
-
bioRxiv - Biochemistry 2019Quote: ... 2 mL of the protein was added to 223 μL Biomix B and 5 μL (5 μg) BirA (both from Avidity) and rocked overnight at 4°C ...
-
bioRxiv - Bioengineering 2022Quote: ... and 10 μL of 5 mM D-biotin (Avidity) were added to the protein along with BirA ligase ...
-
bioRxiv - Biophysics 2022Quote: ... The samples were biotinylated with 5 μg of BirA protein ligase (Avidity) per mg of protein for 1 hr at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... Avi-tagged Env proteins at 25 µM were dialyzed into Tris pH8 and incubated for 5 hours with mild agitation at 30 °C using the BirA biotin-protein ligase reaction kit (Avidity LLC), then reconcentrated prior to size-exclusion chromatography ...