Labshake search
Citations for Avidity :
1 - 12 of 12 citations for 5 Isobutylcyclohexane 1 3 dione 98% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... in-frame with the 3’Avitag (Avidity) sequence GGTCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAA ...
-
bioRxiv - Biochemistry 2021Quote: ... and 5 μg of BirA (Avidity, LLC), to a final volume of 500 μL buffer [20 mM Tris.HCl pH 7.8 ...
-
bioRxiv - Biochemistry 2019Quote: ... 2 mL of the protein was added to 223 μL Biomix B and 5 μL (5 μg) BirA (both from Avidity) and rocked overnight at 4°C ...
-
bioRxiv - Bioengineering 2022Quote: ... and 10 μL of 5 mM D-biotin (Avidity) were added to the protein along with BirA ligase ...
-
bioRxiv - Biophysics 2022Quote: ... The samples were biotinylated with 5 μg of BirA protein ligase (Avidity) per mg of protein for 1 hr at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... Avi-tagged Env proteins at 25 µM were dialyzed into Tris pH8 and incubated for 5 hours with mild agitation at 30 °C using the BirA biotin-protein ligase reaction kit (Avidity LLC), then reconcentrated prior to size-exclusion chromatography ...
-
bioRxiv - Immunology 2023Quote: ... HLA-I/peptide tetramer staining solution was prepared by mixing all tetramers into a solution of 1:1 FACS buffer and Brilliant Buffer containing 0.2% milk and 5μM free D-biotin (Avidity LLC) immediately prior to staining ...
-
bioRxiv - Neuroscience 2023Quote: The amino terminal domain of GluA1 (1-394 a.a.) fused to a biotin acceptor tag (AviTag, Avidity) grown in suspension cultures of Sf9 cells was used as a target for the mRNA display selection ...
-
bioRxiv - Immunology 2022Quote: Purified and Avi-tagged SARS-CoV-2 Wuhan-Hu-1 RBD was biotinylated using the Biotin-Protein Ligase-BIRA kit according to manufacturer’s instructions (Avidity) as described before18 ...
-
bioRxiv - Immunology 2022Quote: Purified and Avi-tagged SARS-CoV-2 Wuhan-Hu-1 RBD and NTD were biotinylated using the Biotin-Protein Ligase-BIRA kit according to manufacturer’s instructions (Avidity) as described before (11) ...
-
bioRxiv - Immunology 2022Quote: ... the S-Avitag substrates were diluted to 40 μM and incubated for 1 h at 30℃ with 15 μg/mL BirA enzyme (Avidity) in 0.05 M bicine buffer at pH 8.3 supplemented with 10 mM ATP ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... On day 1 and 3 mice were placed into test cages which contained sawdust and a cardboard tube and were presented with a 1 % sucrose solution in two sipper sacks (Edstrom-Avidity Science) with drip-free drinking valves ...