Labshake search
Citations for Avidity :
1 - 13 of 13 citations for 4 Amino 3 8 dichloro 5 methoxyquinoline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: The amino terminal domain of GluA1 (1-394 a.a.) fused to a biotin acceptor tag (AviTag, Avidity) grown in suspension cultures of Sf9 cells was used as a target for the mRNA display selection ...
-
bioRxiv - Molecular Biology 2021Quote: ... in-frame with the 3’Avitag (Avidity) sequence GGTCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAA ...
-
bioRxiv - Biochemistry 2021Quote: ... and 5 μg of BirA (Avidity, LLC), to a final volume of 500 μL buffer [20 mM Tris.HCl pH 7.8 ...
-
bioRxiv - Biochemistry 2019Quote: ... 2 mL of the protein was added to 223 μL Biomix B and 5 μL (5 μg) BirA (both from Avidity) and rocked overnight at 4°C ...
-
bioRxiv - Immunology 2022Quote: ... complexes were biotinylated overnight at 4°C using biotin (Avidity), ATP ...
-
bioRxiv - Cell Biology 2022Quote: ... with N-terminal MRGS(H)8 and C-terminal Avi tag was biotinylated in vivo by co-expressing biotin-ligase BirA (pBirAcm from Avidity) in E.coli BL21 (DE3) ...
-
bioRxiv - Bioengineering 2022Quote: ... and 10 μL of 5 mM D-biotin (Avidity) were added to the protein along with BirA ligase ...
-
bioRxiv - Biophysics 2022Quote: ... The samples were biotinylated with 5 μg of BirA protein ligase (Avidity) per mg of protein for 1 hr at room temperature ...
-
bioRxiv - Immunology 2024Quote: ... HLA-DR monomers were biotinylated overnight at 4°C using BirA biotin ligase (Avidity) and purified by size exclusion chromatography using Superdex 200 size exclusion column (AKTA ...
-
bioRxiv - Microbiology 2022Quote: ... Proteins were biotinylated overnight at 4°C using a BirA biotinprotein ligase reaction kit (Avidity) and re-purified using the same HisTrap HP affinity method described above before being flash frozen.
-
bioRxiv - Immunology 2022Quote: ... Secreted protein was purified using HisPur Ni-NTA resin (Thermo) for immobilized metal affinity chromatography (IMAC) and biotinylated overnight at 4°C using biotin (Avidity), ATP ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... rats were water restricted for a period of 4 h and were then placed in test cages containing two sipper sacks (Avidity Science) for 1 h ...
-
bioRxiv - Immunology 2023Quote: ... Avi-tagged Env proteins at 25 µM were dialyzed into Tris pH8 and incubated for 5 hours with mild agitation at 30 °C using the BirA biotin-protein ligase reaction kit (Avidity LLC), then reconcentrated prior to size-exclusion chromatography ...