Labshake search
Citations for Cell Biolabs :
1 - 39 of 39 citations for Tripartite Motif Containing Protein 55 TRIM55 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: Protein lysates were generated using RIPA buffer containing protease inhibitor (Cell Biolabs) on ice for 10 minutes ...
-
bioRxiv - Microbiology 2023Quote: Protein carbonyls were visualized using the OxiSelect Protein Carbonyl Immunoblot Kit (Cell Biolabs). Tnrf1-/- BMDMs were seeded in 24-well plates at 2.5x105 one day prior to infection with indicated L ...
-
bioRxiv - Microbiology 2023Quote: Protein carbonyls were quantified using the OxiSelect Protein Carbonyl ELISA Kit (Cell Biolabs) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: Protein carbonylation was measured using the OxiSelect Protein Carbonyl ELISA Kit (Cell Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... Ten micrograms of total protein were separated on 10% SDS- PAGE gel and were followed by protein blot analysis using mouse anti- methylglyoxal monoclonal antibodies (Cell Biolabs, Catalog number- STA-011).
-
bioRxiv - Physiology 2023Quote: ... Protein oxidation levels were quantified using an OxiSelect Protein Carbonyl ELISA Kit (Cell Biolabs, CA, USA) according to the manufacturer’s instructions.
-
bioRxiv - Physiology 2020Quote: Protein carbonyl levels in heart tissues were measured using OxiSelect protein carbonyl ELISA kit (Cell Biolabs, San Diego, CA) according to the manufacture’s instructions.
-
bioRxiv - Immunology 2022Quote: ... minced tumour was lysed using RIPA buffer containing protease inhibitor (Cell Biolabs) on ice for 10 minutes ...
-
bioRxiv - Physiology 2022Quote: ... Duplicate gels were run to assess protein carbonyls using a kit which derivatises proteins directly on the membrane following transblotting (Cell Biolabs). For this ...
-
bioRxiv - Physiology 2021Quote: ... Protein carbonyls were measured by following the protocol in the commercially available OxiSelect Protein Carbonyl Immunoblot Kit (Cell Biolabs STA-308) as previously performed (Konopka et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... Levels of protein carbonyls [a stable marker of reactive oxygen species (ROS)-induced oxidation] in ALF (using 8 μg of protein) was determined using OxiSelect Protein Carbonyl ELISA Kit (Cell Biolabs, Inc.). Levels of 3-nitrotyrosine-containing proteins [a stable marker of reactive nitrogen species [RNS]-induced oxidation ...
-
bioRxiv - Neuroscience 2021Quote: ... The levels of S protein in different brain regions upon its intranasal infusion were measured using His-Tag protein ELISA kit that allows detection and quantification of poly-histidine-tagged proteins in a biological sample (Cell Biolabs Inc., CA, USA). The experimental procedure was performed as recommended by the manufacturer’s instructions ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: The concentration of oxidized proteins in plasma samples was quantified using the OxiSelect Advanced Oxidation Protein Products (AOPP) Assay Kit (Cell Biolabs, Inc, Cat. No. STA-318). Plasma samples were diluted 1:2 in assay buffer prior to performing the assay according to manufacturer instructions with modifications ...
-
bioRxiv - Cancer Biology 2020Quote: ... Primary antibodies (mouse anti-yH2AX, Cell Biolabs, STA-321 ...
-
bioRxiv - Neuroscience 2021Quote: ... using the AAV-DJ/8 Helper Free Packaging System containing pAAV-DJ/8 and pHelper plasmids (Cell Biolabs). The triple plasmids (AAV-DJ/8-NPGL-IRES-GFP or AAV-DJ/8-IRES-GFP ...
-
bioRxiv - Immunology 2023Quote: ... containing chimeric antigen receptor (CAR) was made using Platinum-E (Plat-E) Retroviral Packaging Cell Line (Cell Biolabs). Fresh virus with human IL-2 was spin fected onto retronectin coated plates according to protocol (33156338) ...
-
bioRxiv - Cancer Biology 2023Quote: 70-150mg of tumor pieces were chopped into small pieces in RIPA buffer containing proteinase inhibitor (Cell BioLabs) and homogenized using OctoMACS (Miltenyi Biotec) ...
-
bioRxiv - Microbiology 2021Quote: ... incubated overnight with anti-His antibody (Cell Biolabs) and finally with horseradish peroxidase-conjugated goat anti-mouse IgG (Jackson Immuno-research Laboratory ...
-
bioRxiv - Biophysics 2021Quote: ... or a LAT-eGFP P2A NFAT-mCherry plasmid-containing supertatants collected from Platinum-Eco cells (Cell Biolabs, San Diego, CA). T cells were imaged on days 5-8 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Membranes were then blocked for 1 hour at room temperature in blocking buffer containing 5% PhosphoBLOCKER blocking reagent (Cell Biolabs) in TBST ...
-
bioRxiv - Bioengineering 2020Quote: MDA-MB-231 breast cancer cell line (triple negative) expressing red fluorescent protein (RFP) (Cell Biolabs) were cultured in DMEM (Gibco ...
-
bioRxiv - Microbiology 2023Quote: Protein carbonylation was measured using the OxiSelect 8-OHdG Oxidative DNA Damage ELISA Kit (Cell Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: mCherry protein levels were detected with the aid of RFP ELISA kit (Cell Biolabs, Inc., USA). All protein samples were diluted to equal concentration prior to loading on antibody plate ...
-
bioRxiv - Neuroscience 2019Quote: ... cassettes targeting murine Kv4.1 sequence (GCTGCCTTCTGGTATACCATT) or containing a non-targeting control sequence (TCGCATAGCGTATGCCGTT) were cloned under mU6 promoter of pAAV-U6-GFP vector (Cell Biolabs). AAV particles were produced in HEK 293T cells by co-transfecting pAAV-RC ...
-
bioRxiv - Immunology 2023Quote: Homology donors comprising sequences to be inserted and flanking homology arms were cloned into plasmid ITR-CMV-GFP (containing ITRs from AAV2; Cell Biolabs) or pVAX by Infusion cloning (Takara) ...
-
bioRxiv - Physiology 2022Quote: ... muscle samples were bead homogenized by a Qiagen Tissuelyser in reducing sample buffer (Tris-HCl, pH 6.8; 2% SDS; 10% glycerol; 1% β-mercaptoethanol) containing protease inhibitors (Cell Biolabs, AKR-190). Samples were centrifuged at 10,000 rpm at 4 °C ...
-
bioRxiv - Genetics 2020Quote: ... Media containing lentiviruses was collected the next day and viral titers were calculated using QuickTiter Lentivirus Titer Kit (Cell Biolabs, Cat# VPK-107). Titers for lentiviral stock were:
-
bioRxiv - Cancer Biology 2023Quote: Cell adhesion to ECM proteins was performed using a CytoSelect 48-well Cell Adhesion Assay Kit (Cell Biolabs) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: The migratory potential of monocytes to supernatants containing chemokines was measured using the CytoSelect 96-well Cell Migration Assay Cell Migration assay (Cell Biolabs, San Diego CA). Briefly ...
-
bioRxiv - Physiology 2021Quote: ... and a marker of protein nitration (3-nitrotyrosine) were measured in sea turtle plasma using ELISA kits (Cell Biolabs catalog numbers ...
-
bioRxiv - Cell Biology 2021Quote: ... and 5 ×104 cells were seeded into 24-well plates containing CytoSelect™ 24-Well Wound Healing Assay inserts (Cell Biolabs, San Diego, CA, USA) (16) ...
-
bioRxiv - Genomics 2019Quote: ... for 120 min at 37 °C and measured by the Boyden chamber method with a 96-well micro-chemotaxis chamber containing a 3-µm pore-sized filter (CELL BIOLABS, INC., San Diego, CA, USA).
-
bioRxiv - Cell Biology 2022Quote: ... and lysates were probed with antibodies directed at 4-HNE (STA-035, Cell Biolabs), GPX4 (MAB5457-SP ...
-
bioRxiv - Cell Biology 2023Quote: ... and the virus titer was measured based on the titer of the viral protein p24 with QuickTiterTM Lentivirus Titer Kit (Cell Biolabs) following the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2021Quote: ROS levels in kidney tissues were assessed by 4-Hydroxynonenal (4-HNE) protein adduct levels measured using the OxiSelect™ HNE Adduct Competitive ELISA kit (STA838, Cell Biolabs) according to the manufacturer’s instruction.
-
bioRxiv - Physiology 2022Quote: ... and subsequently incubated with primary antibody against DNP (Cell Biolab; 1:1000 dilution 5% FSG TBS-T) overnight at 4°C ...
-
bioRxiv - Immunology 2021Quote: Physical particles were determined by measuring p24 levels using the QuickTitre™ Lentivirus Titre which quantifies lentivirus-associated HIV rather than free p24 proteins (Cell Biolabs – VPK-107-T). Manufacturer’s protocol was followed ...
-
bioRxiv - Cell Biology 2023Quote: ... Levels of 3-nitrotyrosine-containing proteins [a stable marker of reactive nitrogen species [RNS]-induced oxidation) in ALF (using 10 μg of protein) were determined using OxiSelect Nitrotyrosine ELISA Kit (Cell Biolabs, Inc., San Diego, CA). Myeloperoxidase (MPO ...
-
bioRxiv - Genomics 2022Quote: Concentrations of LVs and Cas9 VLPs were determined by LV-associated HIV p24 capsid protein (CA)-based ELISA (QuickTiter™ Lentivirus Titer Kit, Catalog Number VPK-107, Cell Biolabs, Inc. San Diego, CA). LVs or VLPs were precipitated according to the manufacturer’s instructions so that soluble p24 protein was not detected.