Labshake search
Citations for Cell Biolabs :
1 - 36 of 36 citations for Mouse IgG2b Isotype Control Antibody A 1 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... Primary antibodies (mouse anti-yH2AX, Cell Biolabs, STA-321 ...
-
bioRxiv - Immunology 2022Quote: ... mouse anti-GAPDH (1:1,000; Cat#: AKR-001, Cell Biolabs Inc.), rabbit-anti Influenza A H1N1 HA (1:1,000 ...
-
bioRxiv - Molecular Biology 2022Quote: ... pEGP-Null was used as a control (Cell Biolabs. INC, San Diego, USA). Firefly and Renilla luciferase activities were measured 48h after transfection using the Dual-Luciferase Reporter Assay Kit (Promega) ...
-
bioRxiv - Plant Biology 2022Quote: ... Ten micrograms of total protein were separated on 10% SDS- PAGE gel and were followed by protein blot analysis using mouse anti- methylglyoxal monoclonal antibodies (Cell Biolabs, Catalog number- STA-011).
-
bioRxiv - Physiology 2022Quote: ... and subsequently incubated with primary antibody against DNP (Cell Biolab; 1:1000 dilution 5% FSG TBS-T) overnight at 4°C ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse monoclonal Rac1 (240106; Cell Biolabs) at 1:100 ...
-
bioRxiv - Neuroscience 2019Quote: ... cassettes targeting murine Kv4.1 sequence (GCTGCCTTCTGGTATACCATT) or containing a non-targeting control sequence (TCGCATAGCGTATGCCGTT) were cloned under mU6 promoter of pAAV-U6-GFP vector (Cell Biolabs). AAV particles were produced in HEK 293T cells by co-transfecting pAAV-RC ...
-
bioRxiv - Cell Biology 2024Quote: ... The mouse fibroblast cell line SNL (Cell Biolabs) was used as feeder cells during the reprogramming process of infected NSCs ...
-
bioRxiv - Immunology 2020Quote: ... by a T2A ribosomal skip sequence and cloned into the pMYs retrovirus backbone under the control of a hybrid MMLV/MSCV promoter (Cell Biolabs Inc). The ffluc sequence was also cloned into the pMYs retrovirus backbone ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Half of the non-treated lysates from the SV-treated RBL-2H3 cells and control RBL-2H3 cells and the treated lysates were incubated with 20 μg GST-Pak1-PBD (for active Rac1) (Cell Biolabs, Inc., USA). Each elution and the remaining half of the lysates were analyzed by SDS-PAGE and detected by western blotting using Rac1 primary antibody.
-
Bilateral regulation of EGFR activity and local PI dynamics observed with superresolution microscopybioRxiv - Cell Biology 2024Quote: ... The amounts of DAG in the DN PLCγ-expressing and control cells were measured with a DAG assay Kit (#MET-5028, Cell Biolabs, Inc. San Diego, CA) according to manufacturer instructions.
-
bioRxiv - Microbiology 2021Quote: ... incubated overnight with anti-His antibody (Cell Biolabs) and finally with horseradish peroxidase-conjugated goat anti-mouse IgG (Jackson Immuno-research Laboratory ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: HDL was isolated from mouse plasma using HDL Purification Kit (Cell BioLabs, Inc.) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... For production of virus for mouse cells platinum E cells (Cell Biolabs, Cat#RV-101) were transfected ...
-
bioRxiv - Biochemistry 2022Quote: ... The mouse Mafa coding sequence was amplified by PCR and subcloned into pAAV-MCS (VPK-410, Cell Biolabs. Inc.).
-
bioRxiv - Genetics 2020Quote: ... and glucose (#STA-681) in mouse plasma were determined using the appropriate kit (all purchased from Cell Biolabs, Inc). Hearts and whole aortas (from the aortic arch to the iliac artery ...
-
bioRxiv - Cell Biology 2022Quote: ... and lysates were probed with antibodies directed at 4-HNE (STA-035, Cell Biolabs), GPX4 (MAB5457-SP ...
-
bioRxiv - Biochemistry 2022Quote: ... The FLAG-tagged mouse Pdx1 coding sequence was amplified by PCR and subcloned into a pMXs-Neo Retroviral vector (RTV-011, Cell Biolabs, Inc.). pGL3-basic-MafA plasmid (−10427/+22 from transcription start site ...
-
bioRxiv - Neuroscience 2021Quote: ... The full-length open reading frame of mouse Npgl was amplified from cDNA of the mediobasal hypothalamus and inserted into the pAAV-IRES-GFP expression vector (Cell Biolabs, San Diego, CA). The primers for mouse NPGL were 5’-CGATCGATACCATGGCTGATCCTGGGC-3’ for the sense primer and 5’-CGGAATTCTTATTTTCTCTTTACTTCCAGC-3’ for the antisense primer.
-
bioRxiv - Neuroscience 2020Quote: ... targeting the open reading frame of mouse Tenascin-R into adeno-associated viral (AAV) vector U6 GFP (Cell Biolabs Inc., San Diego, CA 92126, USA), using BamH1 and EcoR1 restriction sites (Okuda et al ...
-
bioRxiv - Neuroscience 2019Quote: ... trans plasmids pAAV2/1 (Cell Biolabs Inc., Cat# VPK-421), pAAV2/2 (Cell Biolabs Inc. ...
-
bioRxiv - Neuroscience 2023Quote: ... Viruses were produced with Serotype 1 or DJ (Cell Biolabs, Inc.) and purified by CsCl gradients 67 ...
-
bioRxiv - Immunology 2023Quote: ... 800 µl of 1 x reagent B (Cell Biolabs; Cat; MET-5011) was added to the cells/ tissues and further incubated on ice for 10 mins with occasional vortexing ...
-
bioRxiv - Cancer Biology 2022Quote: The Plat-A retroviral packaging cell line (1 ξ 106 cells, Cell Biolabs) was seeded on collagen I-coated six-well plates (4810-010 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 10 μl per 100 μl culture medium of WST-1 reagent (Cell Biolabs, CBA-253) were added to each well ...
-
bioRxiv - Immunology 2021Quote: ... Adhesion of THP-1 cells was measured by Cytoselect Leukocyte-Endothelium Adhesion assay kit (Cell Biolabs, Inc) following suppliers protocol.
-
bioRxiv - Neuroscience 2020Quote: ... EV effects on neuronal membrane integrity were assessed using the ethidium homodimer (EthD-1) assay (Cell Biolabs, San Diego, CA), which is based on the detection of the membrane impermeable EthD-1 dye which fluoresces when bound to DNA ...
-
bioRxiv - Cancer Biology 2023Quote: ... Membranes were then blocked for 1 hour at room temperature in blocking buffer containing 5% PhosphoBLOCKER blocking reagent (Cell Biolabs) in TBST ...
-
bioRxiv - Neuroscience 2024Quote: ... 2017) (Suppl. Table 1) targeting the open reading frame into AAV U6 GFP (Cell Biolabs Inc., San Diego, CA, USA) using BamH1 (New England Biolabs ...
-
bioRxiv - Cell Biology 2020Quote: ... 10 ug of targeting vector was co transfected with 40 ug pDP8 and 200 ul PEI (1 mg/ml) in a P15 of 293AAV cells (AAV-100, Cell biolabs), at 40% confluence ...
-
bioRxiv - Physiology 2022Quote: ... was mixed with collagen solution in a 1:4 ratio of cell suspension and collagen mixture provided in the cell contraction assay (Cell Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: The pri-miR-132 and pri-miR-124 expressing constructs were made by amplifying the pri-miRNA fragments (Supplementary table 1) from miRNASelectTM pEGP-mmu-mirna expression vectors (Cell Biolabs) and subsequently cloning them into the BamHI-BsrGI sites of pRRLSIN.cPPT.SYN.WPRE.
-
bioRxiv - Physiology 2022Quote: ... muscle samples were bead homogenized by a Qiagen Tissuelyser in reducing sample buffer (Tris-HCl, pH 6.8; 2% SDS; 10% glycerol; 1% β-mercaptoethanol) containing protease inhibitors (Cell Biolabs, AKR-190). Samples were centrifuged at 10,000 rpm at 4 °C ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... ref MS E-5100) and 8-hydroxy-2’-deoxyguanosine (“8-OHdG,” in ng.ml− 1; OxiSelectTM Oxidative DNA Damage Elisa kit, Cell Biolabs Inc., ref STA-320) were measured in duplicates from urine samples as indicators of the organisms’ response to environmental stress (Miller et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... shown to be effective against Ncan mRNA (Okuda et al., 2014) (Suppl. Table 1) targeting the open reading frame into AAV U6 GFP (Cell Biolabs Inc., San Diego, CA, USA) using BamH1 (New England Biolabs ...
-
bioRxiv - Neuroscience 2019Quote: ... were generated by the insertion of three different siRNA sequences (obtained from Dharmacon, Horizon Discovery, supplementary table 1) into AAV U6 GFP (CELL BIOLABS INC., San Diego, CA 92126, USA) using BamH1 and EcoR1 restriction sites ...