Labshake search
Citations for Cell Biolabs :
1 - 14 of 14 citations for 26S Proteasome Non ATPase Regulatory Subunit 10 PSMD10 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ELISA assays for GFP-tagged GABAARα subunit expression in the muscle and spinal cord were performed per the manufacturer’s instructions (GFP ELISA Kit, Cell Biolabs). Larvae were anaesthetized in 0.02% tricaine methanesulphonate (10 g/L stock solution ...
-
bioRxiv - Neuroscience 2019Quote: ... cassettes targeting murine Kv4.1 sequence (GCTGCCTTCTGGTATACCATT) or containing a non-targeting control sequence (TCGCATAGCGTATGCCGTT) were cloned under mU6 promoter of pAAV-U6-GFP vector (Cell Biolabs). AAV particles were produced in HEK 293T cells by co-transfecting pAAV-RC ...
-
bioRxiv - Plant Biology 2022Quote: ... Ten micrograms of total protein were separated on 10% SDS- PAGE gel and were followed by protein blot analysis using mouse anti- methylglyoxal monoclonal antibodies (Cell Biolabs, Catalog number- STA-011).
-
bioRxiv - Cancer Biology 2020Quote: ... Primary antibodies (mouse anti-yH2AX, Cell Biolabs, STA-321 ...
-
bioRxiv - Microbiology 2021Quote: ... incubated overnight with anti-His antibody (Cell Biolabs) and finally with horseradish peroxidase-conjugated goat anti-mouse IgG (Jackson Immuno-research Laboratory ...
-
bioRxiv - Biochemistry 2019Quote: ... 10‐20 μg plasmid DNA and 5 μg helper plasmid (pCMV-Gag-Pol, Cell Biolabs) were used ...
-
bioRxiv - Cancer Biology 2023Quote: ... 10 μl per 100 μl culture medium of WST-1 reagent (Cell Biolabs, CBA-253) were added to each well ...
-
bioRxiv - Cell Biology 2022Quote: ... and lysates were probed with antibodies directed at 4-HNE (STA-035, Cell Biolabs), GPX4 (MAB5457-SP ...
-
bioRxiv - Microbiology 2021Quote: ... grown in 10 cm dish were transiently transfected with the following plasmids: 5 µg of pLenti-GFP (Cell Biolabs), 6 µg of psPAX2 and 0.9 µg of pCMV-VSVG (Cell Biolabs) ...
-
bioRxiv - Physiology 2022Quote: ... and subsequently incubated with primary antibody against DNP (Cell Biolab; 1:1000 dilution 5% FSG TBS-T) overnight at 4°C ...
-
bioRxiv - Biochemistry 2023Quote: ... were seeded into 10 cm2 plates and transfected at 90% confluency with 20 µg plasmid DNA and 10 µg helper plasmid (pCMV-Gag-Pol, Cell Biolabs) using CalPhos Mammalian Transfection Kit (Clontech®/Takara ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Cells were verified to be free of residual viral particles 10 days post transduction using the QuickTiter™ Lentivirus-Associated HIV p24 titer kit (Cell BioLabs Inc.).
-
bioRxiv - Physiology 2022Quote: ... muscle samples were bead homogenized by a Qiagen Tissuelyser in reducing sample buffer (Tris-HCl, pH 6.8; 2% SDS; 10% glycerol; 1% β-mercaptoethanol) containing protease inhibitors (Cell Biolabs, AKR-190). Samples were centrifuged at 10,000 rpm at 4 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... Levels of 3-nitrotyrosine-containing proteins [a stable marker of reactive nitrogen species [RNS]-induced oxidation) in ALF (using 10 μg of protein) were determined using OxiSelect Nitrotyrosine ELISA Kit (Cell Biolabs, Inc., San Diego, CA). Myeloperoxidase (MPO ...