Labshake search
Citations for Allele Biotechnology and Pharmaceuticals :
1 - 4 of 4 citations for Recombinant Enhanced Green Fluorescent Protein His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... the C terminus of GL50803_8445 was tagged with an 11-amino acid flexible linker and the fluorescent protein mNeonGreen (Allele Biotechnology). The mNG-N11-Neo vector was constructed for this purpose by amplifying mNeonGreen using the primers listed in Table S1 ...
-
bioRxiv - Cell Biology 2019Quote: ... mNeon green was amplified from pNCS mNeon green (Allele Biotech) with primers GCTTCGAGCTCATCGATGGTGAGCAAGGGCGAGGAGGATA ACATGGCCTC and ATCAGGGATCACTTGTACAGCTCGTCCATGCCCATC.
-
bioRxiv - Cell Biology 2020Quote: ... mNEON-green-β-actin was purchased from Allele Biotechnology. pHalo-C1-NM2C (Halo-NM2C ...
-
bioRxiv - Neuroscience 2023Quote: ... All vectors contain an N-terminal 6x-His-tag, C terminal Strep-Tag II tag, with or without a N or C terminal fluorophore (EGFP, mNeonGreen (Allele Biotech), or mRuby2).