Labshake search
Citations for Lucigen :
1 - 42 of 42 citations for Streptavidin magnetic beads since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... Beads were then removed in the magnetic field and RNase treatment (5µg/µl Epicentre MRNA092) performed for 30 minutes at 37°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... eukaryotic mRNA was enriched with Oligo (dT) beads and prokaryotic mRNA was enriched by removing rRNA with Ribo-ZerotM Magnetic Kit (Epicentre, Madison, WI, USA). The enriched mRNA fragments were then split into short fragments using lysates and reverse transcribed into a strand of cDNA using random primers ...
-
bioRxiv - Plant Biology 2021Quote: ... A Ribo-Zero magnetic kit (MRZPL116, Epicentre) was used for rRNA depletion from total RNA ...
-
bioRxiv - Molecular Biology 2023Quote: Ribo-Zero Magnetic Kit H/M/R (Epicentre/Illumina) was used to remove ribosomal RNAs and to enrich mRNAs ...
-
bioRxiv - Microbiology 2020Quote: ... Ribosomal RNA was depleted using Ribo-ZERO magnetic kit (Epicentre). The transcripts were fragmented and used as templates to generate strand-specific cDNA libraries by TruSeq Stranded Total RNA LT Sample Prep kit (Illumina) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Ribosomal RNA was depleted using the Ribo-Zero magnetic kit (Epicentre). Sequencing libraries of ribosome protected fragments were generated using the ARTseq™ Ribosome Profiling Kit (Epicentre ...
-
bioRxiv - Microbiology 2021Quote: ... Ribosomal RNA was removed using the Ribo-Zero Magnetic Kit (Epicentre). RNA fragmentation ...
-
bioRxiv - Molecular Biology 2024Quote: ... after ribodepletion with the Ribo-Zero Magnetic Kit for yeast (Epicentre) and sequenced on an Illumina HiSeq 4000 instrument.
-
bioRxiv - Microbiology 2020Quote: ... rRNA was removed using a Ribo-Zero Magnetic kit (Epicentre Inc., USA) from each 5 ug of total RNA ...
-
bioRxiv - Microbiology 2020Quote: ... and the rRNA was removed with Ribo-Zero Magnetic Gold Kit (Epicentre, USA). The extracted RNA was reverse transcribed with anchored random primers ...
-
bioRxiv - Microbiology 2020Quote: ... Ribosomal RNA contamination was removed using the Ribo-Zero Magnetic Kit (Bacteria) (Epicentre). Finally ...
-
bioRxiv - Systems Biology 2020Quote: ... ribosomal RNA (rRNA) was removed using the Ribo-Zero Magnetic Kit for bacteria (Epicentre, IL). Metatranscriptome library preparation was performed using the Ion Total RNA-Seq Kit v2 (Life Technologies ...
-
bioRxiv - Microbiology 2020Quote: ... DNAse-treated RNA (5 µg) was mRNA enriched using a Ribo-Zero Magnetic Kit (Epicentre). After Illumina sequencing the reads were mapped to C ...
-
bioRxiv - Genomics 2020Quote: ... and rRNA depletion was performed using Ribo-Zero Magnetic Kit H/M/R (Epicentre/Illumina).
-
bioRxiv - Microbiology 2021Quote: ... and then ribosomal RNA was removed by a Ribo-Zero Magnetic kit (Epicentre Biotechnologies, USA). RNA quality was checked by NanoDrop (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... Ribosomal RNA was depleted from 10μg total RNA using the Ribo-Zero Magnetic Kit (Epicentre). Ribo-depleted RNA was fragmented ...
-
bioRxiv - Molecular Biology 2023Quote: ... Beads were incubated with Tobacco Acid Pyrophosphatase (Epicentre) and washed once with wash buffer ...
-
bioRxiv - Genomics 2020Quote: ... Ribosomal RNA (rRNA) in the samples was depleted by Ribo-Zero Magnetic Kit (Plant Leaf) (Epicentre). Then ...
-
bioRxiv - Microbiology 2021Quote: Ribosomal RNA was removed from strain B50 transcriptomes by using the Ribo-Zero Magnetic Kit (EPICENTRE Biotechnologies ...
-
bioRxiv - Neuroscience 2023Quote: ... The ribosomal RNA was removed from the purified RNAs using the Ribo-Zero magnetic kit (Epicentre). The Ribo-seq library was constructed using the ARTseq™ Ribosome Profiling Kit (Epicentre) ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA samples were depleted of ribosomal RNA with Ribo-ZeroTM Magnetic Gold Kit (cat. # MRZG126 Epicentre). Libraries were constructed on BGI Genomics platform (DNBseq ...
-
bioRxiv - Genetics 2020Quote: ... and ribosomal RNA was depleted using the Ribo Zero Gold Magnetic system (Epicentre/Illumina, San Diego, CA). RNA-seq libraries were prepared with the ScriptSeq v2 kit (Epicentre ...
-
bioRxiv - Molecular Biology 2020Quote: Only cytoplasmic RNA was treated with the Ribo-Zero Magnetic Gold Kit for human/mouse/Rat (Epicentre) to remove ribosomal RNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... while prokaryotic mRNA was enriched by removing rRNA by Ribo-Zero™ Magnetic Kit (Epicentre, Madison, USA). Then the enriched mRNA was fragmented into short fragments using fragmentation buffer and reverse transcripted into cDNA with random primers ...
-
bioRxiv - Microbiology 2023Quote: ... rRNA depletion from total RNA was performed using the Ribo-Zero magnetic kit (Epicentre Biotechnologies, United States) and the mRNA was chemically fragmented to short pieces (200 nt ...
-
bioRxiv - Systems Biology 2023Quote: ... Ribo-ZeroTM rRNA Removal Kits (Bacteria) and Ribo-ZeroTM Magnetic Gold Kit (Yeast) (Epicentre, San Diego, CA) were used to remove rRNA from the total RNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 μg of RNA was treated with a beta version of Ribo-Zero Magnetic Gold Kit Yeast (Epicentre) to deplete rRNAs ...
-
bioRxiv - Molecular Biology 2024Quote: ... Purified RNA was subjected to ribosomal RNA depletion using the Ribo-Zero Magnetic Gold Kit (Human/Mouse/Rat; Epicentre), according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2024Quote: ... Fragments containing the biotinylated adaptor were further purified with Dynabeads M-280 streptavidin (Thermo) and DNA ends were repaired using the End-it DNA End-repair kit (Lucigen). P7 adaptors were ligated to DNA fragments ...
-
bioRxiv - Developmental Biology 2021Quote: ... rRNA was depleted using Ribo-Zero™ Magnetic Gold Kit for rRNA depletion (Human/Mouse/Rat) (Epicentre for Illumina #MRZG12324) according to manufacturer’s guidelines ...
-
bioRxiv - Microbiology 2023Quote: ... and purified DNA-free RNA samples were subjected to ribosomal depletion with Ribo-Zero™ Magnetic Kits (Epicentre®, Singapore), all according to manufacturer’s protocols ...
-
bioRxiv - Cancer Biology 2024Quote: ... Solutions were washed in binding buffer and aspirated on a magnetic plate three times before being resuspended in a PCR master mix (Lucigen Econo Taq 2X 30035-1 and custom primers) ...
-
bioRxiv - Genomics 2022Quote: ... and three libraries for each sex were generated with the NEBNext Ultra RNA library prep kit combined with rRNA depletion via the Ribo-Zero Magnetic Gold kit (Epicentre Biotechnologies). Samples were sequenced on an Illumina HiSeq2500 platform at the Vienna BioCenter Core Facilities (VBCF ...
-
bioRxiv - Microbiology 2024Quote: ... and rRNA was removed from 1 mg of total RNA with Ribo-Zero Magnetic Gold Kit (Epicentre Biotechnologies, Madison, WI, USA). To construct the RNA-Seq library ...
-
bioRxiv - Microbiology 2023Quote: ... underwent a bead-based purification and circularised with CircLigase (Epicentre/Illumina, CL9021K) for 2 hrs ...
-
bioRxiv - Biochemistry 2020Quote: ... Beads were resuspended in PCR master mix (EconoTaq PLUS 2× Master Mix, Lucigen), the DNA was amplified for 15 cycles and purified (QIAGEN) ...
-
bioRxiv - Molecular Biology 2020Quote: 20 µg RNA from each sample was depleted of rRNA using a Ribo-Zero rRNA Magnetic Kit (Epicentre, St Louis, Missouri, United States) including the optional RiboGuard RNase inhibitor according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... strand-specific RNA-Seq libraries facilitating multiplexed paired-end sequencing were prepared from 500 ng total-RNA using the Ribo-Zero Magnetic Gold technology (Epicentre, an Illumina company) for depletion of rRNA followed by library preparation using the ScriptSeq v2 technology (Epicentre) ...
-
bioRxiv - Microbiology 2021Quote: ... beads and multiplexed by using ScriptSeq Index PCR Primers (Epicentre, Illumina, Madison, WI USA). cDNA libraries were quantified by using KAPA Illumina Library Quantification kit (KAPA Biosystems ...
-
bioRxiv - Genomics 2023Quote: ... The resulting plasmid libraries were purified and concentrated via SPRI bead cleanup before being transformed into electrocompetent cells (Lucigen Endura ...
-
bioRxiv - Cell Biology 2024Quote: ... An adapter sequence for Illumina sequencing was ligated to the 3’ of the ssDNA on the beads using Cricligase II (Lucigen#CL9025K). A mixture containing 12.5 pmol ssDNA linker (5’-[phospho]CTGTCTCTTATACACATCTCCGAGCCCACGAGACACTCA[dideoxycytidine]-3’ ...
-
bioRxiv - Genomics 2023Quote: ... About 20,000 prepared barcode beads were resuspended in 40 μl enzyme buffer (1 U/μl Fast-Link DNA Ligase (Lucigen, E0077-2-D3), 20% End-It Enzyme Mix (Lucigen ...