Labshake search
Citations for Lucigen :
1 - 50 of 50 citations for Rat Colony Assay Media since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
A scalable, GMP-compatible, autologous organotypic cell therapy for Dystrophic Epidermolysis BullosabioRxiv - Bioengineering 2023Quote: ... and primers outlined in Table S1. E. coli colony PCRs (Fig. 1F and Fig. S1F- H) were performed with CloneID 1X Colony PCR Mix (Lucigen 30059-2) and primers outlined in Table S1.
-
bioRxiv - Synthetic Biology 2020Quote: ... Colony PCR was performed as follows: 2X EconoTaq Master mix (Lucigen) was used in 20 µL PCR reactions consisting of 10µL of 2X EconoTaq Master mix (Lucigen) ...
-
bioRxiv - Developmental Biology 2022Quote: ... genomic DNA from each colony was harvested with QuickExtract DNA Extraction (Lucigen, QE09050) and then used for PCR amplification ...
-
bioRxiv - Neuroscience 2023Quote: Genomic DNA from individual colonies was isolated using QuickExtract DNA extraction solution (Lucigen). Then ...
-
bioRxiv - Developmental Biology 2021Quote: The cell pellets of picked colonies were resuspended in 10 µl QuickExtract (Epicentre, QE0905T) and the suspension was incubated at 65 °C for 10 min ...
-
bioRxiv - Genomics 2023Quote: ... Resulting colonies were picked and a portion of the cells lysed by QuickExtract (Lucigen, QE9050) and used to genotype by PCR with primers on either side of the insertion site (in most cases with one primer outside the homology arms ...
-
bioRxiv - Genomics 2022Quote: ... coli colonies were picked into 3-5 mL LB-Kan supplemented with CopyControl Induction Solution (Lucigen CCIS125) and cultured overnight at 30°C with shaking at 220 RPM ...
-
bioRxiv - Microbiology 2020Quote: ... DNA was extracted from pure colonies using the MasterPure™Yeast DNA Purification Kit (Epicentre, Madison, WI) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... difficile colonies on TCCFA were transferred to 25 µL of PCR-Lyse™ (Epicentre, Madison, WI, USA) solution ...
-
bioRxiv - Genomics 2023Quote: ... coli colonies were picked into 3-5 mL LB-Kan supplemented with CopyControl Induction Solution (Lucigen CCIS125) and cultured overnight at 30 °C with shaking at 220 RPM ...
-
bioRxiv - Genomics 2021Quote: ... 1 ml of recovery media (Lucigen) was added ...
-
bioRxiv - Genomics 2021Quote: ... 1 ml of recovery media (Lucigen) was added ...
-
bioRxiv - Biochemistry 2021Quote: ... the genomic DNA derived from transfected single cell colonies was extracted with QuickExtractTM DNA Extraction Solution (QE09050, Epicentre) for Sanger sequencing and the genomic DNA with biallelic editing was further subjected to whole-genome sequencing ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... genomic DNA from single colonies was extracted with the MasterPureTM DNA Purification Kit from Epicentre (Cat. No. MCD85201) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Around 10 000 colonies were harvested and pooled prior to DNA extraction using Ready-Lyse Lysozyme (Epicentre Lucigen) and DNAzol (ThermoFischer) ...
-
bioRxiv - Microbiology 2023Quote: ... Around 10 000 colonies were harvested and pooled prior to DNA extraction using Ready-Lyse Lysozyme (Epicentre Lucigen) and DNAzol (ThermoFischer) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Single colonies of each suppressor strain were obtained and genomic DNA was prepped using MasturePure(tm) Yeast DNA Purification Kit (Lucigen). The DHR1 ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR using primers designed to amplify the target region (Forward: CCTTTCTCAGGGCCTCATGTCA; Reverse: GCCTCCAAACAATCAGGGTTGG) was performed with DNA extracted from colonies using QuickExtract (Lucigen). PCR amplified products were screened by restriction digest analysis using the CviAII restriction enzyme (New England Biolabs) ...
-
bioRxiv - Cancer Biology 2021Quote: ... One of the plates was used for quick genomic DNA isolation for each of the colonies using QuickExtract DNA extraction solution (Lucigen # QE09050). 5μl of this lysate was used to set up a quick genomic PCR screening for IL-1β knockout clones using checking primers ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Electroporations were recovered in 1 mL recovery media (Lucigen) for 1 hour and subsequently grown overnight in LB + selection.
-
bioRxiv - Molecular Biology 2019Quote: ... rRNA was depleted using the Ribo-Zero kit Human/Mouse/Rat (Epicentre), and libraries were prepared using random priming ...
-
bioRxiv - Molecular Biology 2020Quote: ... with ribosomal depletion using Human/Mouse/Rat Ribo-Zero kit (Epicentre/Illumina). All samples were sequenced using a 100 base-pair (bp ...
-
bioRxiv - Molecular Biology 2020Quote: ... PCR screening of the colonies was performed using genotyping oligos listed in Supplementary Table 1 using Quick Extract DNA Extraction Solution (Lucigen Catalog Number: QE09050) according to manufacturer’s protocol in a PCR machine and DreamTaq Green Polymerase (Thermo Fisher Scientific Catalog Number ...
-
bioRxiv - Genomics 2019Quote: ... Gram-negative and Human/mouse/rat Ribo-Zero rRNA Removal Kit (Epicentre Technologies). The resulting RNA was purified using Zymo RNA clean & Contentrator-5 column kit (ZYMO Research) ...
-
bioRxiv - Systems Biology 2023Quote: ... and recovered for one hour at 37°C in Recovery Media (Lucigen). Aliquots from the transformations were used to inoculate overnight cultures of LB containing 25 μg/mL of Zeocin (ThermoFisher) ...
-
bioRxiv - Genomics 2020Quote: ... media was aspirated and 50-100 μL QuickExtract™ DNA Extraction Solution (Lucigen) were added to each well ...
-
bioRxiv - Molecular Biology 2020Quote: Only cytoplasmic RNA was treated with the Ribo-Zero Magnetic Gold Kit for human/mouse/Rat (Epicentre) to remove ribosomal RNA ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5µg of total RNA was subjected to rRNA depletion using the RiboZero Human/Mouse/Rat kit (Epicentre Biotechnologies). cDNA was generated from the depleted RNA using random hexamers or custom primers and Superscript III (Life Technologies ...
-
bioRxiv - Molecular Biology 2019Quote: ... Total RNA was depleted of ribosomal RNA using Ribo-Zero rRNA Removal Kit (Epicentre/Illumina, Human/Mouse/Rat) and library preparation was completed using NEBNext® Ultra Directional RNA Library Prep Kit for Illumina® (New England Biolabs) ...
-
bioRxiv - Biochemistry 2022Quote: ... the media was removed by aspiration and 100μl of Quick Extraction solution (Epicentre, Madison, WI) was added to lyse the cells (65°C for 20 min and then 95°C for 20 min) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Purified RNA was subjected to ribosomal RNA depletion using the Ribo-Zero Magnetic Gold Kit (Human/Mouse/Rat; Epicentre), according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... rRNA was depleted using Ribo-Zero™ Magnetic Gold Kit for rRNA depletion (Human/Mouse/Rat) (Epicentre for Illumina #MRZG12324) according to manufacturer’s guidelines ...
-
bioRxiv - Molecular Biology 2021Quote: ... Ribosomal RNA (rRNA) was depleted from RNA used for transcriptome analysis using Ribo-Zero rRNA Removal Kit (Human/Mouse/Rat) (Epicentre) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... were sent to BGI (Hongkong) for ribosomal RNA depletion using Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Epicentre) followed by library construction using non-stranded (Replicate 1 ...
-
bioRxiv - Immunology 2019Quote: ... The DNase-treated RNA (2 μg) was treated with Ribo-Zero using an Epicentre Ribo-Zero Gold Kit (Human/Rat/Mouse) (Epicentre) and re-purified on Ampure XP beads.
-
bioRxiv - Molecular Biology 2023Quote: Total RNA from collected tissues and primary cultures was isolated using a standard TRIzol protocol followed by ribodepletion with a Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) according to the manufacturer’s instructions (Epicentre; RZG1224). Strand-specific libraries were prepared using a TruSeq RNA Sample Preparation Kit (Illumina ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA from collected tissues and primary cultures was isolated using a standard TRIzol protocol followed by ribodepletion with a Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) according to the manufacturer’s instructions (Epicentre; RZG1224). Strand-specific libraries were prepared using a TruSeq RNA Sample Preparation Kit (Illumina ...
-
bioRxiv - Systems Biology 2020Quote: ... Purified RNA (2.5 μg) was used for ribosome depletion using a Ribo-Zero™ Gold Kit (Human/Mouse/Rat) (Epicentre Biotechnologies) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... 5μg of RNA was subjected to ribosomal and mitochondrial RNA depletion using the RiboZero Gold kit (Human/Mouse/Rat, Epicentre #MRZG12324) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: One microgram of total RNA was rRNA depleted using the Ribo-Zero rRNA Removal Kit (Human, Mouse, Rat) (Epicentre, Madison, WI, USA) followed by a purification step using AMPure XP Beads (Beckman Coulter ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Cells grown on YES solid media were used for genomic DNA preparation using the MasterPure Yeast DNA Purification Kit (Epicentre). The kit manufacturer’s protocol was followed ...
-
bioRxiv - Microbiology 2021Quote: ... culture media (Lab M) and the other one into a microfuge tube containing 350 μL Tissue and Cell Lysis buffer (Epicentre) and 100 μg 0.1 mm zirconia beads (BioSpec Products ...
-
bioRxiv - Microbiology 2022Quote: ... Cell samples were grown to mid-log in rich media and DNA was collected using a MasterPure Gram Positive DNA (Epicentre) purification kit with modifications as previously described [53] ...
-
bioRxiv - Microbiology 2023Quote: ... 500uL of the cultured cells were pelleted and the growth media was removed. DNA was extracted using the Master Pure DNA purification kit (Cat No. 85200) from Epicentre. NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® (NEB #E7645S/L ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Cells were maintained under regular media exchange until reaching ∼90% confluency when editing was analyzed by extracting genomic DNA using QuickExtract (Lucigen).
-
bioRxiv - Genomics 2023Quote: ... the media was removed and genomic DNA was extracted using 30 uL/well of QuickExtract DNA Extraction Solution (Lucigen #QE09050) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... C-circle and G-circles assays were performed as before except that NxGen phi29 DNA Polymerase (Lucigen Corp.) were used for rolling circle amplifications [25].
-
bioRxiv - Molecular Biology 2021Quote: ... C-circle and G-circles assays were performed as before except that NxGen® phi29 DNA Polymerase (Lucigen Corp.) were used for rolling circle amplifications [25].
-
bioRxiv - Biochemistry 2024Quote: The mRNA coding for the catalytic mutant AGOs used in the equilibrium binding assay was transcribed in vitro using the AmpliScribe T7 High Yield Transcription Kit (Lucigen), employing the corresponding pBYL-3×FLAG-SUMO-catalytic mutant AGO plasmids linearized with Not I as templates ...
-
bioRxiv - Molecular Biology 2023Quote: ... 10 μg RNA extracted from the specific tethering assays was incubated in a 20 μl reaction volume with 1 unit of Terminator 5’- phosphate-dependent exonuclease (Epicentre) for 60 min at 30°C ...