Labshake search
Citations for Agilent :
1 - 26 of 26 citations for R + SCH 23390 hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2021Quote: ... 3′-diaminobenzidine tetra-hydrochloride chromogen (DAB, K3468, Dako) was added to all sections and the reaction was stopped with distilled water ...
-
bioRxiv - Immunology 2021Quote: ... Prior to conjugation, R-Phycoerythrin (R-PE, 240kDa) (Prozyme, Hayward, CA) was extensively dialyzed into phosphate-buffered saline (PBS ...
-
bioRxiv - Cancer Biology 2020Quote: ... using R-Phycoerythrin-conjugated anti-IgM (DAKO). Following incubation ...
-
bioRxiv - Immunology 2024Quote: ... anti-CD31/Pecam1 (R&D Systems 1:200, Dako), and F4/80 (1:200 ...
-
bioRxiv - Genetics 2024Quote: ... and the quality was evaluated by capillary electrophoresis (Agilent (R)) using the RNA Integrity Number (RIN) ...
-
bioRxiv - Immunology 2023Quote: ... or R-phycoerythrin-cyanine-7 (PE-Cy7) fluorochromes (Prozyme, Thermo-Fisher).
-
bioRxiv - Immunology 2023Quote: ... or cyan-7 conjugated R-phycoerythrin (PECy7) fluorochrome-conjugated streptavidin (Prozyme, Thermo-Fisher).
-
bioRxiv - Evolutionary Biology 2022Quote: Libraries DN and R were synthesised as a SurePrint oligonucleotide pool by Agilent (DE). Oligonucleotides were specified to include NdeI and XhoI restriction sites 5’- and 3’ to the CDS for downstream cloning ...
-
bioRxiv - Microbiology 2021Quote: ... at RT for 1 h followed by incubation with streptavidin R-Phycoerythrin (PE, Agilent Technologie) at RT for 30min ...
-
bioRxiv - Biophysics 2021Quote: ... The MutL (R-E) mutation was generated using the QuikChange site-directed mutagenesis kit (Stratagene). Two serine residues separated the his6 and srt ...
-
bioRxiv - Immunology 2024Quote: ... Fc receptors were biotinylated and bound to Streptavidin-R-Phycoerythrin (Agilent, Santa Clara, CA, USA) at a 1:1000 dilution ...
-
bioRxiv - Microbiology 2020Quote: Steady-state fluorescence emission anisotropy (r) was measured with a Cary Eclipse Fluorescence Spectrophotometer (Agilent Technologies) equipped with a thermostated cuvette holder ...
-
bioRxiv - Genetics 2021Quote: ... Two oligos (F: GCGATGCCACCTAGGGCAAGCTGACCCTG and R: CAGGGTCAGCTTGCCCTAGGTGGCATCGC) were used with the QuikChange II mutagenesis kit (Agilent, 200523). We confirmed that this mutation (GFPstop ...
-
bioRxiv - Developmental Biology 2024Quote: ... R/A at the indicated time points (Seahorse XF Mito Stress Test Kit, 103015-100, Agilent, USA). Readings were then normalized to protein concentration/well measured using the Micro BCA™ Protein Assay Kit.
-
bioRxiv - Cell Biology 2021Quote: ... An inducible V-1 expression plasmid was created by first PCR- amplifying the mtpn gene with V-1 F and V-1 R oligos (dictyBase:DDB_G0268038) using Ax2 genomic DNA then TA cloning the product using StrataClone (Agilent) to generateV-1 SC ...
-
bioRxiv - Microbiology 2020Quote: ... the primer pair dsbS(H235A)-F/R and a QuikChange II site-directed mutagenesis kit (Stratagene, catalog#:200518) were used ...
-
bioRxiv - Cell Biology 2023Quote: ... These data analysis was performed in the R computing environment and GeneSpring GX software version 13.0 (Agilent Technologies).
-
VPS13B is localized at the cis-trans Golgi complex interface and is a functional partner of FAM177A1bioRxiv - Cell Biology 2023Quote: ... and a randomly selected subset of these embryos was assayed for the target locus disruption through genotyping PCR using vps13b_geno_F/R primers (see Supplementary materials Table S1) and resolving the resulting PCR products on Fragment Analyzer (Agilent).
-
bioRxiv - Immunology 2022Quote: ... CF (R&D/BT10500-050) was incubated at a 4:1 molar ratio with either streptavidin-PE (Prozyme PJRS25) or streptavidin-APC (Prozyme PJ27S ...
-
bioRxiv - Cell Biology 2021Quote: ... Proteins were transferred to a nitrocellulose membrane before probing using a primary anti IL-36γ antibody (Biotechne (R&D) UK) overnight at 4°C and a secondary goat antibody (Dako) for 1 hour at room temperature to visualise any protein cleavage.
-
bioRxiv - Microbiology 2020Quote: ... and ZIKV X1 C35G R (5’-GCCTGCTAGTCAGGCACAGCTTGGGGA-3’) were used with a QuikChange II XL Site-Directed Mutagenesis Kit (Agilent) to introduce the X1 C10415G mutation into the p2-ZIKV plasmid ...
-
bioRxiv - Bioengineering 2024Quote: ... and rotenone/antimycin A (R/A) (0.5 μM) were measured using an XF96 Extracellular Flux Analyzer (Seahorse Bioscience, Madison, WI). Data was exported into Excel (V2311 ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA integrity (RIN R 8.0) was confirmed using the High Sensitivity RNA Analysis Kit (DNF-472-0500, Agilent formerly AATI) on a 12-Capillary Fragment Analyzer ...
-
bioRxiv - Molecular Biology 2021Quote: The hydrophobic residues Phe5 and Leu7 in LepB TMH1 were replaced with arginine (R) in construct N = 55 by site-directed mutagenesis using PfuUltra II Fusion HS DNA Polymerase (Stratagene, Sweden). Multiple alanine substitutions (underlined ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1 μL of SST1-F/R PCR product was cloned into pSC-A-amp/kan vector using Strataclone™ PCR Cloning Kit (Agilent, Cat.#240205) following manufacturer’s instructions and transformed into E ...
-
bioRxiv - Genomics 2020Quote: ... Blots were washed three times with TBST for 15min at room temperature and subsequently incubated for 2h at room temperature with HRP-conjugated secondary antibodies (goat anti-rabbit, Dako; rabbit anti-goat, R&D Systems) at a dilution of 1:5000 in TBST ...