Labshake search
Citations for Agilent :
351 - 400 of 739 citations for 4 4 Methylphenyl 1H pyrrole 3 carbonitrile since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... and incubated overnight at 4°C in primary antibody (2% NGS in TBST) with either rabbit anti-GFAP (1:2000, Agilent Cat# Z0334, RRID: AB_10013382), rabbit anti-synaptophysin (IgG ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2-4 images at the central callus and distal callus regions were taken using an automatic microscope (Agilent, BioTek Lionheart FX, Santa Clara, CA). Central callus regions were defined as proximal to the fracture site on either side of the bone ...
-
bioRxiv - Neuroscience 2024Quote: ... was performed on blood and hiPSC genomic DNA using the SurePrint G3 Human CGH Microarray Kit 4 x 180K in accordance with the manufacturer’s instructions (Agilent Technologies, Palo Alto, CA, USA). Probe positions are referred to human genome assembly GRCh37/hg19.
-
bioRxiv - Cancer Biology 2023Quote: ... samples were incubated with FSCN1 primary antibodies at 4°C overnight and the color of the sample was developed using the DAKO ChemMate Envision Kit HRP (Dako-Cytomation, Carpinteria, CA, USA) followed by counterstaining with hematoxylin ...
-
bioRxiv - Molecular Biology 2023Quote: ... The hybridization was performed according to the manufacturer instructions on 4×180K mouse microarrays (SurePrint G3 Mouse CGH Microarray Kit, 4x180K, AGILENT Technologies, reference genome: mm9). Microarrays were scanned with an Agilent High-Resolution C Scanner using a resolution of 3 µm and the autofocus option ...
-
bioRxiv - Cancer Biology 2024Quote: ... The slides were incubated overnight at 4 °C with anti-CA125 mouse monoclonal antibody (Clone M11, Agilent Dako, Santa Clara, CA, USA 1:1000). Dako’s Envision diaminobenzidine (DAB ...
-
bioRxiv - Cancer Biology 2024Quote: ... The slides were incubated overnight at 4 °C with anti-CA125 mouse monoclonal antibody (Clone M11, Agilent Dako, Santa Clara, CA, USA 1:1000). Dako’s Envision diaminobenzidine (DAB ...
-
bioRxiv - Pathology 2024Quote: ... or human IPF lung fibroblasts treated with NVP-BHG712 or vehicle (n=4 per treatment group) were assessed using an RNA Nano chip on an Agilent Bioanalyzer (Agilent, Santa Clara, CA, USA). RNA integrity numbers for all samples were >9.5 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 70 islets per mouse (n = 4 mice/group) were handpicked after 48 hours of chemical exposure and washed with Seahorse XF RPMI media (Agilent Technologies, 103576, pH 7.4) supplemented with 2 mM sodium pyruvate ...
-
bioRxiv - Molecular Biology 2020Quote: All 2D heteronuclear 15N-1H NMR experiments were acquired on a 11.75 Tesla Varian 500 MHz VNMRs system (Agilent Technologies Inc., Palo Alto, CA) with an operational frequency of 499.84 MHz ...
-
bioRxiv - Cancer Biology 2021Quote: 1H-MRS experiments were carried out in a 14.1 Tesla animal scanner with a 28-cm horizontal bore (Agilent Technologies, Palo Alto, CA, USA) using the SPECIAL sequence (TR = 4s ...
-
bioRxiv - Neuroscience 2024Quote: ... Nuclear magnetic resonance (NMR) spectra including the 1H and 13C NMR spectra were recorded on a Varian Mercury Plus 400 NMR spectrometer (Agilent Technologies, Santa Clara, CA). Proton chemical shifts are reported as parts per million (δ ppm ...
-
bioRxiv - Neuroscience 2021Quote: ... Primary antibodies diluted in blocking solution were incubated overnight at 4°C (anti-GFAP z0334 DAKO 1:400, anti-Iba1 019-19741 Wako 1:400). After three washes in PBS ...
-
bioRxiv - Microbiology 2020Quote: ... Sample quality control was assessed using a Qubit 4 Fluorometer (using Qubit™ dsDNA BR assay Kit) and Agilent 2200 TapeStation (using Agilent D5000 ScreenTape assay kit). Library construction and sequencing was undertaken at Novogene (Beijing ...
-
bioRxiv - Cancer Biology 2022Quote: ... explants treated with BrdU substrate for 24 hours prior to fixation as described in Section 6.3.1) (DAKO, Cat. M0744; 1:50 overnight at 4 °C), cytokeratin (DAKO ...
-
bioRxiv - Cancer Biology 2023Quote: ... in 3 cycles for 3 hours using the Seahorse XFe24 analyzer system (Agilent Technologies). Inhibitors and substrates were used at the following concentrations ...
-
bioRxiv - Cell Biology 2020Quote: ... diluted 1:33 in BSA 1% in PBS without Ca2+ and Mg2+for 1h at RT or with negative isotype control mouse IgG2a (cat. X0943 - Agilent Technologies, Santa Clara, CA, USA). Then ...
-
bioRxiv - Microbiology 2023Quote: ... 3 × 150 mm column (Agilent), column temperature 50 °C ...
-
HNF4α isoforms regulate the circadian balance between carbohydrate and lipid metabolism in the liverbioRxiv - Genomics 2021Quote: ... Liver NE from WT and α7HMZ mice were prepared as previously described (Yuan et al., 2009).A custom-designed array was ordered from Agilent (SurePrint G3 Custom GE 4×180k), which contained oligonucleotides ∼60 nucleotides (nt ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’-TTTAAT-3’à5’-TTggAAT-3’) using the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Cell Biology 2021Quote: ... 3-diaminobenzidine (DAB) solution (Dako, USA) until signal was detected ...
-
bioRxiv - Cancer Biology 2022Quote: ... and KI67 (clone TEC-3, Dako) were then incubated on the tissue slices and bound antibody was detected with biotinylated goat anti-rat IgG (Southern Biotechnology) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’-diaminobenzidine tetrahydrochloride (DAB; Dako, K3467), as chromogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’ diaminobenzidine (DAB) (Dako, Carpinteria, CA) and counter-staining was done with hematoxylin ...
-
bioRxiv - Biochemistry 2023Quote: ... or a BIOSEC 3 column (Agilent; flow rate ...
-
bioRxiv - Molecular Biology 2022Quote: 3*10^3 of HPLFs per well were seeded into Seahorse XFe96 well plate (Agilent Technologies, 200941) for overnight ...
-
bioRxiv - Cancer Biology 2022Quote: ... fixed tissues were embedded in paraffin and 4 mm sections were histologically processed for hematoxylin-eosin staining and immunohistochemistry using anti-human Ki67 antibody (DAKO #M7240, 1:75, 30 min at 37°C). All these procedures were performed using standardized protocols by Atrys Health S.A.
-
bioRxiv - Cell Biology 2024Quote: ... Step 3 was endogenous peroxidase blocking (Dako REAL Peroxidase-blocking reagent ...
-
Machine learning and data-driven inverse modeling of metabolomics unveil key process of active agingbioRxiv - Systems Biology 2024Quote: ... Gas separation was performed on the HP-5MS column (30 m 3 0.25 mm 3 0.25 mm, Agilent Technologies).
-
bioRxiv - Physiology 2020Quote: ... Acetone was measured using an agilent DB-35MS column (30 m 3 0.25mm i.d. 3 0.25 mm, Agilent J&W Scientific) installed in an Agilent 7890A gas chromatograph (GC ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR amplification of the full-length 16S rRNA gene with universal primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGACTT-3’) (Miller et al. 2013)was performed by using the Pfu Turbo DNA polymerase (Agilent) under the following conditions ...
-
bioRxiv - Biophysics 2024Quote: ... using a 3 × 3 mm black walls quartz cell at 25 °C on an Agilent Cary Eclipse spectrofluorometer (Agilent Technologies) equipped with a thermostatted cell holder attached to an Agilent PCB 1500 water Peltier system ...
-
bioRxiv - Developmental Biology 2024Quote: ... By site-directed mutagenesis the V5 tag of the pMT-Bip V5-His A vector was replaced by a Myc sequence (EQKLISEEDL) using the primers: Fw: 5’– AGCGAAGAGGATCTGACGCGTACCGGTCATCAT–3 and 5’– AATCAGTTTCTGTTCGAATTCCACCACACTGGACTAGTAGGTACC–3’ and the PFU ultra (Agilent). The cDNA for Drospondin without the signal peptide sequence and the stop codon was amplified using the clone GH02025 from Drosophila Genome Resource Center (DGRC) ...
-
bioRxiv - Biochemistry 2020Quote: ... using the enzymes α(2–3) sialidase (Prozyme), α(2–3,6,8 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Fragment 3 was pBluescript KS (-) (Stratagene, California USA), which was digested using Xba ...
-
bioRxiv - Pathology 2021Quote: ... 3′-diaminobenzidine tetra-hydrochloride chromogen (DAB, K3468, Dako) was added to all sections and the reaction was stopped with distilled water ...
-
bioRxiv - Microbiology 2022Quote: ... 3’ Diaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions) was applied for eight minutes ...
-
bioRxiv - Microbiology 2022Quote: ... 3’ Diaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions) was applied for eight minutes ...
-
bioRxiv - Microbiology 2023Quote: ... then labeled using Cyanin-3 CTP (Agilent Technologies) and hybridized on chips containing 45000 probes (4×44K Whole Human Genome) ...
-
bioRxiv - Microbiology 2023Quote: ... 3 × 150 mm 2.7 μm HPLC column (Agilent) with a Poroshell 120 PFP ...
-
bioRxiv - Microbiology 2024Quote: ... anti-Cluster of Differentiation 3 (CD3; Agilent Dako), anti-Paired box protein-5 (Pax-5 ...
-
bioRxiv - Microbiology 2024Quote: ... anti-Cluster of Differentiation 3 (CD3; Agilent Dako), anti-Paired box protein-5 (Pax-5 ...
-
bioRxiv - Bioengineering 2021Quote: ... were extracted from freeze-dried sludge samples with a 3 h digestion time and 3% sulfuric acid and then analyzed by a gas chromatography-mass spectrometry (GC-MS) (Agilent, USA) with 7890A-5975C model (Lanham et al. ...
-
bioRxiv - Molecular Biology 2024Quote: ... The supernatants were fractionated on a reversed-phase Supelco Discovery BIO wide Pore C18-3 (4.6 × 150 mm, 3 µm particle size) column operated by a HPLC Agilent 1200 (Agilent Technologies, Waldbronn, Germany) chromatography system ...
-
bioRxiv - Biophysics 2023Quote: ... The cells were fixed with 3% formalin 3 days after the transfection and analyzed with the ACEA Quanteon (Agilent NovoExpresss Version 1.5.0), as described (22 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Anti-Ki-67 (Antigen Clone TEC-3) antibody (Dako), anti-Cleaved Caspase 3 (Asp175 ...
-
bioRxiv - Genomics 2020Quote: ... Ki67 (rat, DAKO M7249, clone TEC-3, 1:100), Carbonic Anhydrase 2 (rabbit ...
-
bioRxiv - Immunology 2023Quote: ... the peroxidase was blocked with 3% hydrogen peroxide (DAKO) for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... Agilent Bio SEC-3 Column (Agilent Technologies, CA, USA) or HiLoad 16/60 Superdex 200 pg SEC column (GE Healthcare ...