Labshake search
Citations for Agilent :
251 - 300 of 1566 citations for 3 2 Bromophenyl 9 phenyl 9H carbazole since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... Krt8/18 (DAKO M365201-2), GATA6 (R&D AF1700 ...
-
bioRxiv - Neuroscience 2021Quote: ... GFAP (Agilent, Cat# Z033429-2) Stained sections with only secondary antibodies were used as controls ...
-
bioRxiv - Neuroscience 2021Quote: ... GFAP (Agilent/Dako, Z033429-2), Lectin (Vector Labs ...
-
bioRxiv - Neuroscience 2021Quote: ... GFAP (Agilent/Dako, Z033429-2), Lectin (Vector Labs ...
-
bioRxiv - Synthetic Biology 2020Quote: ... coli BL21 Rosetta 2 (Stratagene) by induction with 1 mM IPTG in 2X YT medium at 20°C overnight ...
-
bioRxiv - Physiology 2021Quote: ... DAB chromogen (Agilent, K346889-2) with hematoxylin counter stain (Agilent ...
-
bioRxiv - Cancer Biology 2021Quote: ... bluing buffer (Dako, CS70230-2) for 90 seconds and finally in Eosin Y (Sigma ...
-
bioRxiv - Cell Biology 2020Quote: ... coli BL21 Rosetta 2 (Stratagene) using the plasmids described above by induction at OD600=0.8 with 1 mM IPTG in 2X YT (Streptavidin-GFP-GFP ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 2 mM glutamine (Agilent). Cells were allowed to attach at RT for 15 min and then transferred to a 37°C incubator without CO2 for 40 min ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 glutamine (Agilent #103579-100) in XF DMEM medium (Agilent #103575-100)] in atmospheric air at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: ... Diaminobenzidine (Agilent, Cat#K346811-2) was used as a chromogen and finally ...
-
bioRxiv - Physiology 2023Quote: ... 2 μM of FCCP (Agilent), and 0.5 μM of rotenone AA (Agilent ...
-
bioRxiv - Cell Biology 2022Quote: ... pH 9.0 (Agilent, S236784-2) for 10 minutes was used for MMP13 and p16 antigen retrieval ...
-
bioRxiv - Developmental Biology 2023Quote: ... Insulin (1:2, Dako IR002), Integrin-α6 (1:400 ...
-
bioRxiv - Physiology 2023Quote: ... and 2 mM pyruvate (Agilent) and the mitochondria concentration assessed by Pierce BCA Protein Assay (Thermo) ...
-
bioRxiv - Cancer Biology 2024Quote: ... anti-BCL-2 (Dako #M0887) and anti-β-actin (EMD Millipore #MAB1501) ...
-
bioRxiv - Neuroscience 2024Quote: ... Bluing Buffer (Agilent; CS70230-2) was applied to each tissue section until covered and incubated for 2 minutes at room temperature ...
-
bioRxiv - Cell Biology 2024Quote: ... and 2 mM glutamine (Agilent)) ...
-
bioRxiv - Genomics 2020Quote: ... A D1000 Screen Tape assay (Agilent, Cat.5067-5582/3) was used with the 2200 Tape Station (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... and anti-CD15 (mouse monoclonal, clone Carb-3, Agilent Dako) antibodies were used ...
-
bioRxiv - Cancer Biology 2021Quote: ... and anti-CD15 (mouse monoclonal, clone Carb-3, Agilent Dako) antibodies were used ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and endogenous peroxidase was blocked with 3% hydrogen peroxide (DAKO) for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... 150 x 2.0 mm Polaris 3 C8-A column (Agilent, Middelburg ...
-
bioRxiv - Microbiology 2024Quote: ... or 3) a HiPlex H column (4.6 x 250mm, Agilent). For 1) ...
-
bioRxiv - Microbiology 2024Quote: ... connected to a BioTek BioStack 3 microplate stacker (Agilent Technologies).
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Molecular Biology 2024Quote: ... Horseradish peroxidase (HRP)-conjugated secondary antibodies were from Dako (cat # P026002-2 and cat # P021702-2) and detected using either SuperSignal West Pico PLUS Chemiluminescent Substrate (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 mM Sodium Pyruvate (Agilent, 103578), and 1 mM Glutamine (ThermoFisher ...
-
bioRxiv - Developmental Biology 2020Quote: ... PECAM1/CD31 (Agilent Technologies, M082329-2), PECAM1/CD31 (R&D Systems ...
-
bioRxiv - Neuroscience 2020Quote: ... Hematoxylin (Agilent Technologies; Cat S330930-2) was pipetted onto each section until completely covered and incubated for 7 minutes ...
-
bioRxiv - Cancer Biology 2020Quote: ... High pH (Agilent DAKO, K800421-2). 1X EnVision FLEX Wash Buffer (Agilent DAKO ...
-
bioRxiv - Immunology 2022Quote: ... CD3 170Er (polyclonal, A045229-2, Dako), CD4 156Gd (clone EPR6855 ...
-
bioRxiv - Developmental Biology 2022Quote: ... and anti-SMA (M085129-2, Agilent). Anti-Perlecan antibody was a kind gift from Dr ...
-
bioRxiv - Cancer Biology 2020Quote: ... or anti-S100A1antibody (Dako, Z031129-2). Immunostained slides were counterstained with hematoxylin (Sigma) ...
-
bioRxiv - Neuroscience 2020Quote: ... Ki67 (Dako #M724001-2, 1:200). Full immunohistology protocol details available at http://help.brain-map.org/download/attachments/8323525/CellTypes_Morph_Overview.pdf?version=4&modificationDate=1528310097913&api=v2
-
bioRxiv - Cancer Biology 2021Quote: ... Low pH (Agilent Dako, S236984-2) in a PT Link instrument (Agilent Dako ...
-
bioRxiv - Cancer Biology 2021Quote: ... Low pH (Agilent Dako, S236984-2) in a PT Link instrument (Agilent Dako ...
-
bioRxiv - Neuroscience 2021Quote: ... CD31 (Agilent, GA61061-2, 1:100), Olig2 (Millipore ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2 μl of SureSelect probes (Agilent) were mixed with 2 μl of 25% RNAse block ...
-
bioRxiv - Immunology 2021Quote: ... HRP anti-Rabbit (Agilent, K400311-2) and EnVision+ Single Reagents ...
-
bioRxiv - Cancer Biology 2020Quote: ... High pH (Agilent DAKO, K800421-2). 1X EnVision FLEX Wash Buffer (Agilent DAKO ...
-
bioRxiv - Immunology 2020Quote: ... CD68 (Agilent, #GA60691-2, Clone KP1), Cleaved Caspase 3 (CST ...
-
bioRxiv - Bioengineering 2021Quote: ... anti-PMEL (Agilent Technologies, #M063429-2), anti-ACTA2 (Sigma-Aldrich #C6198) ...
-
bioRxiv - Systems Biology 2023Quote: ... Epoch 2 (BioTek, now: Agilent Technologies) or Infinite 200 Pro (TECAN trading AG ...
-
bioRxiv - Cancer Biology 2023Quote: ... High pH (Agilent DAKO, K800421-2) for DKC1 slides and EnVision FLEX Target Retrieval Solution ...
-
bioRxiv - Cancer Biology 2023Quote: ... Low pH (Agilent DAKO, K800521-2) for Ki67 slides ...
-
bioRxiv - Cancer Biology 2023Quote: ... Low pH (Agilent DAKO, K800521-2) for Ki67 slides ...
-
bioRxiv - Cancer Biology 2023Quote: ... High pH (Agilent DAKO, K800421-2) for DKC1 slides and EnVision FLEX Target Retrieval Solution ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μl 10x AffinityScript buffer (Agilent), 2 μl 0.1 M DTT ...
-
bioRxiv - Pathology 2023Quote: ... stained with hematoxylin (S330130-2, Agilent) and stored at 4 °C ...