Labshake search
Citations for Agilent :
201 - 250 of 3323 citations for 4 Chloro 6 fluorobenzene 1 3 diamine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2021Quote: ... Antigen retrieval was performed using citrate-based pH 6 antigen retrieval solution (Dako) for 1 min at 120°C and allowed to cool to 90°C in a decloaking chamber ...
-
bioRxiv - Genomics 2022Quote: ... RNA quality (RNA integrity number > 6) was confirmed via Fragment Analyzer (Agilent, USA). RNA was treated with DNase I and reverse-transcribed using SuperScript III (Thermo Fisher ...
-
bioRxiv - Biochemistry 2021Quote: ... 4 mL capacity (Agilent Cat. #: 5185-5991) and centrifuged at 17,172 × g for 45 min at 4 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... The supernatants were fractionated on a reversed-phase Supelco Discovery BIO wide Pore C18-3 (4.6 × 150 mm, 3 µm particle size) column operated by a HPLC Agilent 1200 (Agilent Technologies, Waldbronn, Germany) chromatography system ...
-
bioRxiv - Biophysics 2023Quote: ... The cells were fixed with 3% formalin 3 days after the transfection and analyzed with the ACEA Quanteon (Agilent NovoExpresss Version 1.5.0), as described (22 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Anti-Ki-67 (Antigen Clone TEC-3) antibody (Dako), anti-Cleaved Caspase 3 (Asp175 ...
-
bioRxiv - Immunology 2023Quote: ... the peroxidase was blocked with 3% hydrogen peroxide (DAKO) for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... Agilent Bio SEC-3 Column (Agilent Technologies, CA, USA) or HiLoad 16/60 Superdex 200 pg SEC column (GE Healthcare ...
-
bioRxiv - Microbiology 2023Quote: ... using the Bio SEC-3 300A HPLC column (Agilent) and an isocratic elution with 100 mM ammonium acetate (pH 7.0 ...
-
bioRxiv - Genomics 2022Quote: ... we established an automated 3’UTR-seq (QuantSeq 3’mRNA-seq; Lexogen GmbH, Vienna) using the Agilent NGS Workstation (Agilent Technologies, Santa Clara) at The Centre for Applied Genomics (TCAG ...
-
bioRxiv - Biophysics 2024Quote: ... Fluorescence measurements were carried out using 3×3 mm quartz cuvettes (Hellma Analytics, LineaLab, Badalona, Spain) in a Cary Eclipse spectrofluorimeter (Agilent Technologies, Madrid, Spain). Blanks in the absence of protein were routinely measured and subtracted ...
-
bioRxiv - Developmental Biology 2022Quote: ... The PVDF membranes were blocked in 5 % nonfat dry milk diluted in Tris-buffered saline with 0.05 % Tween-20 for 1 h at room temperature and then incubated overnight at 4 °C with antibodies against FN (1:70000, rabbit anti-fibronectin, DAKO, Hamburg, Germany). After washing with TBS-T ...
-
bioRxiv - Molecular Biology 2022Quote: ... Adapter dilution (1:4) and PCR amplification (26 cycles) were optimized in a pilot experiment using Bioanalyzer DNA1000 (Agilent, Sant Clara, USA) chips as a read out of library size and quantity ...
-
Retinal affectation in Huntington’s disease mouse models concurs with a local innate immune responsebioRxiv - Neuroscience 2023Quote: ... and incubated overnight in a humid chamber at 4°C with rabbit anti-glial fibrillary acidic protein (GFAP) antibody (1:500, Z0334, DAKO, Agilent, Glostrup, Denmark), rabbit anti-ionized calcium binding adaptor molecule 1 (Iba-1 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Both oligo libraries (Round 5, and Round 6 + mutational scanning) were purchased from Agilent.
-
bioRxiv - Immunology 2021Quote: ... mouse thymocytes were exposed to 254 nm UV-irradiation for 6 minutes (Stratagene Stratalinker) followed by labelling with 2 μM CFSE (Life Technologies ...
-
bioRxiv - Immunology 2023Quote: ... the heat-induced antigen retrieval was performed in Target Retrieval solution (pH 6) (Dako) for 1 hour ...
-
bioRxiv - Immunology 2023Quote: Heat-induced antigen retrieval was performed in either Target Retrieval solution (pH 6) (Dako) or in EDTA (pH 8.5 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Antigen retrieval was carried out using citrate buffer solution pH 6 (Dako, Glostrup, Denmark). Detection was performed using the EnVision method (Dako ...
-
bioRxiv - Physiology 2024Quote: ... antigen retrieval was performed in boiling 10 mM citrate buffer pH 6 (Dako; #S2369) for 30 min and sections were incubated 30 min with Fab antibody ...
-
bioRxiv - Developmental Biology 2024Quote: Cas13d mediated knockdown at 6 hpf: High quality RNA once passed through Bioanalyzer (Agilent) with RIN score more than 7.5 were used for library preparation ...
-
bioRxiv - Developmental Biology 2024Quote: ... squashed specimens were placed in DAKO Real Target Retrieval Solution (pH 6) (S2031; DAKO) and heated in a microwave oven (MI-77 ...
-
bioRxiv - Cancer Biology 2024Quote: ... the sections were incubated with primary antibody (PRDX2, TFRC or 4-HNE) at 4°C overnight and followed by incubation with secondary antibody FLEX/HRP (Dako) at room temperature for 30 min ...
-
bioRxiv - Cell Biology 2024Quote: ... Step 4 was protein blocking (Background Sniper, Dako Protein Block or Normal block ...
-
bioRxiv - Genomics 2020Quote: ... A D1000 Screen Tape assay (Agilent, Cat.5067-5582/3) was used with the 2200 Tape Station (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... and anti-CD15 (mouse monoclonal, clone Carb-3, Agilent Dako) antibodies were used ...
-
bioRxiv - Cancer Biology 2021Quote: ... and anti-CD15 (mouse monoclonal, clone Carb-3, Agilent Dako) antibodies were used ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and endogenous peroxidase was blocked with 3% hydrogen peroxide (DAKO) for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... 150 x 2.0 mm Polaris 3 C8-A column (Agilent, Middelburg ...
-
bioRxiv - Microbiology 2024Quote: ... or 3) a HiPlex H column (4.6 x 250mm, Agilent). For 1) ...
-
bioRxiv - Microbiology 2024Quote: ... connected to a BioTek BioStack 3 microplate stacker (Agilent Technologies).
-
bioRxiv - Neuroscience 2023Quote: ... Afterwards the sections were incubated in a humidified chamber (overnight 4°C) in a peroxidase conjugated immunoglobulin against UEA (DAKO, P289; 1:50). Finally ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were incubated for 1h at RT before overnight incubation at 4°C with primary antibodies: Glial Fibrillary Acidic Protein (GFAP) (1/500 Dako Cat. Number Z0334); AQP4 (1/500 ...
-
Retinal affectation in Huntington’s disease mouse models concurs with a local innate immune responsebioRxiv - Neuroscience 2023Quote: ... and incubated overnight in a humid chamber at 4°C with rabbit anti-glial fibrillary acidic protein (GFAP) antibody (1:500, Z0334, DAKO, Agilent, Glostrup, Denmark), rabbit anti-ionized calcium binding adaptor molecule 1 (Iba-1 ...
-
bioRxiv - Neuroscience 2024Quote: ... they were incubated overnight at 4°C with the respective primary antibodies: (i) polyclonal rabbit anti-GFAP (1:2000; Dako, Cat. No. Z0334); (ii ...
-
bioRxiv - Bioengineering 2024Quote: ... The solvent was then diluted with water (DMSO:water = 1:4) and subjected to purification through preparative reverse-phase HPLC chromatography (Agilent 1260 Infinity II HPLC). The chromatographic separation was carried out on an Agilent Prep-C18 column (250 mm × 21.2 mm × 10 μm ...
-
bioRxiv - Bioengineering 2024Quote: ... The solvent was then diluted with water (DMSO:water = 1:4) and subjected to purification through preparative reverse-phase HPLC chromatography (Agilent 1260 Infinity II HPLC). The chromatographic separation was carried out on an Agilent Prep-C18 column (250 mm × 21.2 mm × 10 μm ...
-
bioRxiv - Bioengineering 2024Quote: ... The solvent was then diluted with water (DMSO:water = 1:4) and subjected to purification through preparative reverse-phase HPLC chromatography (Agilent 1260 Infinity II HPLC). The chromatographic separation was carried out on an Agilent Prep-C18 column (250 mm × 21.2 mm × 10 μm ...
-
bioRxiv - Pathology 2023Quote: ... Sections from the first level (main experiment) were stained for smooth muscle alpha-2 actin (ACTA2) and galectin 3 (LGALS3) using mouse monoclonal anti-ACTA2 (Dako, cat. no. M0851, 1:100) after blocking with Fab fragment (Jackson ImmunoResearch ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Biochemistry 2021Quote: ... tissue sections were deparaffinized and permeabilized by citrate buffer (pH 6) for 25 min (Dako). Slices were blocked with 5% donkey serum (37°C ...
-
bioRxiv - Immunology 2020Quote: ... cDNA for Sp110 CARD (aa 6-110) were amplified from MegaMan Human Transcriptome Library (Stratagene). cDNA for the tandem SUMO interaction motifs of RNF4 (aa 38-129 ...
-
bioRxiv - Microbiology 2023Quote: ... using an ion-exchange column (Agilent Hi-Plex H, 300 × 7.7 mm, 6 μm I.D.) with isocratic elution using 5 mM H2SO4 at 50 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... Slides were then microwaved in the presence of DakoCytomation target retrieval solution pH 6 (Dako). Slides were incubated with 0.3% hydrogen peroxide solution in methanol for 15 minutes at room temperature to inhibit internal peroxide activity ...
-
bioRxiv - Biochemistry 2024Quote: ... pre-incubated for at least 30 min at 6 °C within the Vialsampler (G7129A, Agilent), and then loaded on a Superdex 200 Increase 10/300 column (Cytiva ...
-
bioRxiv - Cell Biology 2020Quote: ... Germany) followed by overnight incubation at 4 °C with specific primary antibodies: polyclonal rabbit anti-human AAT (1:800) (DAKO A/S, Glostrup, Denmark), mouse monoclonal anti-AAT polymer antibody (clone 2C1 ...
-
bioRxiv - Neuroscience 2020Quote: ... and incubated overnight at 4°C in primary antibody (2% NGS in TBST) with either rabbit anti-GFAP (1:2000, Agilent Cat# Z0334, RRID: AB_10013382), rabbit anti-synaptophysin (IgG ...
-
bioRxiv - Cancer Biology 2024Quote: ... The slides were incubated overnight at 4 °C with anti-CA125 mouse monoclonal antibody (Clone M11, Agilent Dako, Santa Clara, CA, USA 1:1000). Dako’s Envision diaminobenzidine (DAB ...
-
bioRxiv - Cancer Biology 2024Quote: ... The slides were incubated overnight at 4 °C with anti-CA125 mouse monoclonal antibody (Clone M11, Agilent Dako, Santa Clara, CA, USA 1:1000). Dako’s Envision diaminobenzidine (DAB ...
-
bioRxiv - Biochemistry 2021Quote: ... at 4°C overnight diluted in antibody diluent (Dako). Negative controls were incubated with antibody diluent only ...