Labshake search
Citations for Origene Technologies :
1 - 32 of 32 citations for PGK Promoter Lin28 Lentivirus since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2024Quote: ... or mock lentivirus (Origene LentiOrf cat ...
-
bioRxiv - Neuroscience 2023Quote: ... Lentivirus Concentrator (OriGene technologies Cat # TR30025) was added to the supernatant ...
-
bioRxiv - Neuroscience 2023Quote: ... Lentivirus Concentrator (OriGene Technologies Cat.# TR30025) was added to the supernatant and incubated overnight at 4 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... Culture media containing lentivirus were collected 48-72h post transfection and concentrated using lentivirus concentration solution (Origene) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... before transduction with lentivirus (empty vector (Origene, PS100092) or human GPR87 ORF (Origene ...
-
bioRxiv - Cancer Biology 2022Quote: ... The lentivirus concentration was quantified by Lenti ELISA Kit (Origene). After 16h ...
-
bioRxiv - Neuroscience 2020Quote: The plasmid encoding AAV-PGK-chst3 was made by amplifying the mouse chst3 sequence from plasmid MR207541 (OriGene) via the primers 5’ GGAATTCATAGGGCGGCCGGGAA 3’ and 5’ AGCGCTGGCCGGCCGTTTAAAC 3’ and was cloned into plasmid AAV-PGK-Cre (Addgene plasmid # 24593 ...
-
bioRxiv - Microbiology 2021Quote: ... The lentivirus contained the human ACE2 gene under control of the CMV promoter along with green fluorescent protein (GFP) also under control of a separate CMV promoter (Origene Technologies, Rockville, MD). A MOI of 20 was used for lentivirus transduction ...
-
bioRxiv - Neuroscience 2023Quote: ... Lentivirus transduction for mGFP (pLenti-C-mGFP-P2A-Puro - Origene Cat# RC211875L4V), CLU_mGFP (CLU(mGFP-tagged)- human clusterin(CLU ...
-
bioRxiv - Molecular Biology 2022Quote: ... with the CMV promoter from pCMV6-Entry (Origene Cat# PS100001). BamHI-HF and NdeI restriction enzymes were used for both plasmids ...
-
bioRxiv - Neuroscience 2021Quote: ... a CMV promoter driven rat RTN3 plasmid was purchased from Origene, Rockville ...
-
bioRxiv - Neuroscience 2021Quote: ... a CMV promoter driven rat RTN3 plasmid was purchased from Origene, Rockville ...
-
bioRxiv - Developmental Biology 2021Quote: ... cells were transduced (MOI=2) with a lentivirus constitutively expressing GFP (OriGene Tech # PS100093V). A pure GFP population was generated with puromycin selection for a few days in culture before use in experiments and cell line storage.
-
bioRxiv - Molecular Biology 2021Quote: ... 1×104 cells were mixed with mock or Igfbp2 lentivirus (catalog # MR204287L3V; OriGene Technologies) at MOI=80 in the 500 ml of 10 µg/ml polybrene/DMEM-F12 ...
-
bioRxiv - Microbiology 2024Quote: ... FOS cDNA under the T7 promoter was used as a template (OriGene). Following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Lentivirus containing supernatant was concentrated 1:50 as described by the manufacturer (Origene, catalog # TR30026), flash frozen in liquid nitrogen and stored at −80°C ...
-
bioRxiv - Systems Biology 2022Quote: ... lentivirus was generated as described above using plenti-CMV-Puro-DEST containing MORC3 (OriGene Technologies, RC210530) or SETDB1 (OriGene Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... the transgenic LGALS1 KD BTSCs were generated via lentivirus carrying two different LGALS1 shRNA plasmids (OriGene, #TL311756). LGALS1 KD BTSC73 lines were established by antibiotic selection (0.5 μg/mL puromycin) ...
-
bioRxiv - Immunology 2022Quote: ... stable cell lines were produced using commercially designed lentivirus particles targeting mouse Gsdmc2 (NM_001168274.1) and Gsdmc3 (NM_183194.3) (Origene #HC108542): shRNA HC1008542A– AGTATTCAATACCTATCCCAAAGGGTTCG ...
-
bioRxiv - Genetics 2024Quote: ... Cells were transduced with 40μL of either RTFDC1-DDK lentivirus (OriGene LentiOrf cat: RC201652L3V, >107 TU/mL) or mock lentivirus (Origene LentiOrf cat ...
-
bioRxiv - Immunology 2022Quote: ... The lentivirus containing media was harvested 72 h after transfection and concentrated 80 times using Lenti Concentrator (Origene). LV particles were then resuspended in RPMI 1640 media without serum and stored at −80°C before use ...
-
bioRxiv - Cell Biology 2024Quote: ... CGI-58- and PNPLA2-overexpressing cell lines were generated by transducing Hep3B WT and I148M cells (250,000 cells/well of a 6-well plate) with lentivirus (Origene, CGI-58 RC201869L3V and PNPLA2 RC205708L3V) ...
-
bioRxiv - Genomics 2021Quote: ... 1.0 μg of linear donor cassette with EF1a promoter followed by eGFP-P2A-Puromycin resistance (OriGene, KN519669D) and 2.0 μl of P3000 reagent per μl DNA was diluted into 125 μl of serum-free Opti-MEM ...
-
bioRxiv - Neuroscience 2023Quote: ... we used a plasmid containing SNX27-FLAG under CMV promoter (pCMV-SNX27-FLAG, OriGene Technologies plasmid #MR218832). For SNX27 knockdown experiments ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... CGGBP1 knockdown was done using CGGBP1-shRNA (targeting four different regions in ORF) using lentiviral transduction by overexpression of CGGBP1-lentivirus constructs acquired from Origene. The lenti-packaging plasmids ...
-
bioRxiv - Cancer Biology 2022Quote: ... ASNS overexpression was achieved via transfection of a murine ASNS expression vector under a CMV6 promoter (MC200523, OriGene). Cells were transfected in 6-well plates with Lipofectamine 2000 (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... Stably transduced THF expressing human Flt-3R were generated by transduction with the lentivirus pLenti-FLT3-mGFP-P2A-Puro (OriGene Technologies RC211459L4V) followed by GFP purification after one week of Puro (800 μg/ml ...
-
bioRxiv - Cancer Biology 2023Quote: Cells expressing shMdm2 or shScramble were sorted for GFP positive cells and transduced with lentivirus carrying a pool of shRNAs against Sprouty4 (4 different shRNAs purchased from OriGene, cat.#HC108594) or shScramble sequence as control (OriGene ...
-
bioRxiv - Cancer Biology 2023Quote: ... HT1080 p53KO cells were transduced with lentivirus carrying a pool of shRNAs against Mdm2 (4 different shRNAs purchased from OriGene, cat.#TL311529) or shScramble sequence as control (OriGene ...
-
bioRxiv - Immunology 2023Quote: ... and either with a lentiviral expression vector carrying GFP-tagged MCEMP1 ORF or insertless (mock) vector for MCEMP1 overexpression (lentivirus were purchased from Origene, MD, USA). A MOI of 50 was necessary to achieve a satisfactory infection rate ...
-
bioRxiv - Immunology 2023Quote: A plasmid vector constitutively expressing the Rorc gene under the control of the CMV promoter (pCMV6-Rorc) (Origene, No. MR222309) was co-transfected with a plasmid expressing the luciferase gene (Luc ...
-
bioRxiv - Neuroscience 2023Quote: ... we used plasmids containing scrambled shRNA and anti-SNX27 shRNA under the CMV promoter (pCMV-scr-shRNA, pCMV-shSNX27, Origene Technologies #TL518223). All plasmid DNA were purified using the ZymoPure II (Zymo Research ...