Labshake search
Citations for Origene Technologies :
1 - 21 of 21 citations for Non Ab Component of Alzheimer's Disease Amyloid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... for 30 min before addition to the other components: 10 nM tGFP Ab (TA150041, OriGene), anti-FLAG donor and protein G coated acceptor beads (10 ng/μl final concentration ...
-
bioRxiv - Cancer Biology 2019Quote: ... 70nM non-targeting siRNA (Origene, SR30004) or RELA siRNA (Origene ...
-
bioRxiv - Molecular Biology 2019Quote: ... or non-silencing siRNA (SR30004, OriGene) using Lipofectamine RNAi max (Thermo Fisher Scientific).
-
bioRxiv - Immunology 2020Quote: ... Mouse anti-Myc (9E10) Ab was from Origene (USA); Rabbit anti-GM130 was from Abcam (United Kingdom) ...
-
bioRxiv - Cancer Biology 2019Quote: ... GAS1 Rabbit Polyclonal Ab (Origene Cat# AP51781PU-N, Lot# SH08D402D), NME1/NDKA (NM23-H1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... was purchased from Sigma Aldrich and mouse anti-PDLIM2 Ab (1:250) was purchased from Origene. Rabbit anti-FAK Abs (1:500) ...
-
bioRxiv - Cancer Biology 2019Quote: Replication incompetent lentivirus were produced in HEK 293T cells co-transfected by mixing 5 µg of either pLKO.1 Empty Vector or pLKO.1 shRNA targeting SMARCD3 with 6 µg Lenti-vpak packaging kit components (OriGene) and 33 µL of transfection reagent (OriGene ...
-
bioRxiv - Neuroscience 2023Quote: ... or vector encoding non-targeting shRNA (shControl; TR30021, OriGene Technologies) were packed in LV by cotransfection with psPAX2 (gift from Didier Trono ...
-
bioRxiv - Cancer Biology 2019Quote: ... pCMV6-AC Tagged Cloning mammalian vector with non-tagged expression (Origene, CAT#: PS100020), KDELR3 transcript variant 2 (NM_016657 ...
-
bioRxiv - Immunology 2022Quote: ... HC108542B–AGTTGTGTTGTCCAGTTTCCTGTCCATGC and scrambled negative control non-effective shRNA (Origene Item no: TR30023). Lentivirus was packaged by co-transfecting shRNA and psPAX2 and pVSVG packaging plasmids into HEK293T cells ...
-
bioRxiv - Molecular Biology 2021Quote: ... with each well transfected with non-targeting (siCtrl) or YTHDC1-targeted siRNAs (siDC1, Origene # SR314128 ...
-
bioRxiv - Genomics 2021Quote: The Zcchc8 KN2.0 non-homology mediated mouse gene knockout kit (KN519669) was purchased from OriGene. Either the pCas-Guide CRISPR vector (OriGene ...
-
bioRxiv - Neuroscience 2022Quote: ... non-silencing hairpin control (HIV-GFP-shscr) were obtained from Origene (Cat# TL710108 and #TL711639). All expression plasmids (listed in Table S4 ...
-
bioRxiv - Cell Biology 2023Quote: ... The same plasmid containing non-specific shRNA was used as a control (OriGene RNAi, 0415). The cells were transfected using Lipofectamine 3000 (L3000008 ...
-
bioRxiv - Cancer Biology 2019Quote: Non-tagged PITX1 or ZCCHC10 expression vector was inserted into the pCMV6-XL5 vector (Origene, Rockville, MD, USA). PITX1 ΔHD1 ...
-
bioRxiv - Immunology 2021Quote: ... Locus ID 5893) and non-effective Trilencer-27 Flurescent-labeled transfection control siRNA duplex (SR30002) were obtained from Origene Technologies ...
-
bioRxiv - Biochemistry 2022Quote: Lentiviral pGFP-shHKII vector encoding human shRNAHKII (Cat# TL312415) and non-silencing control pGFP-C-shLenti vector (Cat#: TR30023) were purchased from OriGene Technologies Inc (Rockville ...
-
bioRxiv - Cell Biology 2020Quote: A non-tagged construct of mouse Gdf3 was generated using the commercial vector pCMV6-Gdf3-Myc-Flag (OriGene Technologies, MR222967), containing a Myc-Flag-tagged Gdf3 ...
-
bioRxiv - Bioengineering 2022Quote: Anti-HER2 monoclonal antibodies were used as primary antibodies in a series of Western Blots on cellular lysates of wild-type HEK293T (non-expressing HER2) cells (Origene LY500001) and HEK293T overexpressing HER2 (Origene LY417979) ...
-
bioRxiv - Biochemistry 2020Quote: Viral vectors expressing lentiviral particles with 4 unique 29mer target-specific shRNA (A/B/C/D) to murine PRDX4 and 1 scramble control (non-specific or NS) were purchased from Origene (Rockville, MD). MIN6 cells were seeded on 48 well plates and cultured overnight in 0.3 mL medium ...
-
bioRxiv - Neuroscience 2021Quote: ... constructs in the pGFP-V-RS vector and a non-targeting (NT: gcactaccagagctaactcagatagtact) pGFP-V-RS plasmid were purchased from OriGene (Cat. # TL515175). For lentivirus-mediated expression ...