Labshake search
Citations for DNAStar :
1 - 12 of 12 citations for Mouse Mesoderm Specific Transcript Protein MEST ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2019Quote: ... we built morphotype-specific transcriptomes using SeqMan NGen (DNAStar). Initial mapping utilized default parameters (mer size ...
-
bioRxiv - Plant Biology 2020Quote: ... Specific primers for CcAOS were designed with PrimerSelect 5.03 (DNASTAR Inc., Madison, WI, USA) (forward 5’-3’ CACGCGTCGATTTATTGTCC and reverse 5’-3’ TTTGGTGGGTTCGGCTTGTT).
-
bioRxiv - Genomics 2020Quote: ... a specific primers pair was designed based on the mRNA sequences of Gallus gallus by DNASTAR software ...
-
bioRxiv - Genomics 2022Quote: ... a specific primers pair was designed based on the mRNA sequences of Gallus gallus by DNASTAR software ...
-
bioRxiv - Microbiology 2023Quote: ... Protein sequence alignments were performed using MegAlign Pro (DNAstar). Superimposed images of protein structures were generated using ChimeraX Matchmaker84 ...
-
bioRxiv - Microbiology 2020Quote: ... Nucleotide and protein sequences were analyzed using Lasergene Software Package (DNASTAR, Madison, WI, USA). Resistance gene references were selected in GenBank database.
-
bioRxiv - Immunology 2020Quote: ... Multiple protein sequences were aligned using the MegAlign program of the LASERGENE software suite (DNASTAR). The SWISS-MODEL prediction algorithm (https://swissmodel.expasy.org/ ...
-
bioRxiv - Microbiology 2023Quote: ... The visualization of proteins sequences alignment was generated using ClustalW in MegAlign Pro (v17.5.0, DNASTAR).
-
bioRxiv - Genomics 2020Quote: Nucleotide variation for the proteins was detected from their nucleotide sequencing and amino acid variations were estimated (DNASTAR). 3D structure of the derived protein was estimated for both indigenous ducks and chicken by Pymol software ...
-
bioRxiv - Biochemistry 2020Quote: ... predict the transmembrane and transmembrane directions of ACE2 encoded protein and Kyte-Doolittle method predicts the hydrophilic region by DNASTAR software.
-
bioRxiv - Microbiology 2023Quote: ... predicted atomic protein docking interactions between Ank5 and the NLRC5 NACHT domain using the SwarmDock algorithm.135 Protean 3D (DNASTAR) was used to visually depict the NovaDock predictions.
-
bioRxiv - Microbiology 2024Quote: RNA conservation within WT strains was aligned using Smitt-Watermen RNA alignment and protein conservation within WT strains was generated using ClustalW Multiple Sequence alignment with MegAlign Pro (DNASTAR; Version 17.4.1.17).