Labshake search
Citations for American BioInnovations, :
1 - 3 of 3 citations for Rubella Spike Glycoprotein E1 strain F Therien since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... F Treatment with ABI (Sham+ABI and GDX+ABI pooled) reduced the number of overall errors ...
-
bioRxiv - Neuroscience 2021Quote: ... F Treatment with ABI (Sham+ABI and GDX+ABI pooled) reduced the number of overall errors ...
-
bioRxiv - Genetics 2020Quote: ... followed by PCR amplification (ncoa3CRISPR F: FAM-ATGAATGAGCAAGGCCACAT; ncoa3CRIPSR R: GGACTTGCTCCCATTTTAGG) and subjected to fragment length analysis (ABI 3500) to test gRNA efficiency (90% efficiency rate detected) ...