Labshake search
Citations for American BioInnovations, :
1 - 16 of 16 citations for Recombinant Rat Fc Fragment Of LgG Low Affinity IIb Receptor CD32 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... Gene fragment insert in the recombinant plasmid was sequenced by an automated sequencer (ABI prism) using the dideoxy chain termination method with T7 and SP6 primers (Chromous Biotech ...
-
bioRxiv - Genomics 2022Quote: ... Gene fragment insert in the recombinant plasmid was sequenced by an automated sequencer (ABI prism) using the dideoxy chain termination method with T7 and SP6 primers (Chromous Biotech ...
-
bioRxiv - Biochemistry 2019Quote: ... Human CENP-C482-527 fragment (CENP-CCD) (19) and rat CENP-C710-740 (CENP-CCM) (ABI Scientific, Sterling, VA) was added in 2.2-fold or 4-fold molar excess to CENP-A nucleosomes ...
-
bioRxiv - Microbiology 2021Quote: ... All cells were supplemented with 10% (v/v) fetal calf serum (FCS) (ABI) at 37 °C in 5% CO2 ...
-
bioRxiv - Genetics 2021Quote: ... RFLP fragments were separated in a genetic analyzer (ABI model 3130) using POP-7 polymer ...
-
bioRxiv - Microbiology 2020Quote: ... Low ROX (QuantaBio)’ master mix on an ABI 7500 Fast Real-Time PCR System (ABI).
-
bioRxiv - Genetics 2019Quote: ... The resulted PCR fragments were electrophoresed with GeneScan 500 LIZ size standard (Applied Biosystems, ABI) in ABI3130 (ABI ...
-
bioRxiv - Biochemistry 2024Quote: RNA oligonucleotides used for binding affinity measurements and crystallographic studies were synthesized on an ABI 394 DNA/RNA synthesizer (Applied Biosystems (ABI); Waltham ...
-
bioRxiv - Genetics 2019Quote: ... DNA fragment detection with 1bp resolution was performed with an automated DNA sequencer (ABI 3130, Applied Biosystems) and size determination was obtained with GeneMapper 4.1 (Applied Biosystems) ...
-
bioRxiv - Plant Biology 2023Quote: ... by using the HieffTM qPCR SYBR Green Master Mix (Low Rox Plus, cat no. 11202ES08, Yeasen, Shanghai, China) on a QuantStudio 6 Flex PCR (ABI). The qPCR signals were normalized to those of the reference gene PST in pine trees ...
-
bioRxiv - Microbiology 2023Quote: ... Real-time PCR was performed using ChamQ SYBR qPCR Master Mix (Low ROX Premixed) (Vazyme, China) and detected by ABI 7500 system (Applied Biosystems ...
-
bioRxiv - Plant Biology 2024Quote: ... with Hieff™ qPCR SYBR Green Master Mix (Low Rox Plus, cat no. 11202ES08, Yeasen, Shanghai, China) on a QuantStudio 6 Flex PCR system (ABI). The qPCR signals were normalized to those of the reference gene PST in Pinus by applying the 2-ΔΔCT method (Fang et al. ...
-
bioRxiv - Genetics 2020Quote: ... followed by PCR amplification (ncoa3CRISPR F: FAM-ATGAATGAGCAAGGCCACAT; ncoa3CRIPSR R: GGACTTGCTCCCATTTTAGG) and subjected to fragment length analysis (ABI 3500) to test gRNA efficiency (90% efficiency rate detected) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Cells used in experiments were within twenty passage numbers from arrival into the laboratory and were routinely verified by their short tandem repeat profiles using fragment analysis (ABI 3730XL DNA Analyzer ...
-
bioRxiv - Genomics 2022Quote: ... were inserted in recombinant plasmid which was sequenced by dideoxy chain termination method with T7 and SP6 primers in an automated sequencer (ABI prism, Chromous Biotech, Bangalore).
-
bioRxiv - Genomics 2021Quote: ... were inserted in recombinant plasmid which was sequenced by dideoxy chain termination method with T7 and SP6 primers in an automated sequencer (ABI prism, Chromous Biotech, Bangalore).