Labshake search
Citations for American BioInnovations, :
1 - 21 of 21 citations for Recombinant Human CD79B protein Fc tagged R PE labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... only those voxels labeled (by the ABI) as part of the neural plate were selected ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Purified templates were dye labeled using BigDye (ABI) and sequenced on an ABI 3077 automated DNA Sanger sequencer.
-
bioRxiv - Microbiology 2021Quote: ... All cells were supplemented with 10% (v/v) fetal calf serum (FCS) (ABI) at 37 °C in 5% CO2 ...
-
bioRxiv - Neuroscience 2020Quote: ... Real time PCR reactions were carried out in MicroAmp optical tubes (PE ABI) in a 25 μl mix containing 8 % glycerol ...
-
bioRxiv - Genomics 2020Quote: ... Gene fragment insert in the recombinant plasmid was sequenced by an automated sequencer (ABI prism) using the dideoxy chain termination method with T7 and SP6 primers (Chromous Biotech ...
-
bioRxiv - Genomics 2022Quote: ... Gene fragment insert in the recombinant plasmid was sequenced by an automated sequencer (ABI prism) using the dideoxy chain termination method with T7 and SP6 primers (Chromous Biotech ...
-
bioRxiv - Molecular Biology 2021Quote: ... using human Col1a1 and Acta2 primers from ABI for the specified gene and species.
-
bioRxiv - Neuroscience 2022Quote: ... We used reconstructed human neuron morphologies from ABI for the L5 Pyr neuron (Neuron ID ...
-
bioRxiv - Neuroscience 2020Quote: ... Quantities of targets in test samples were normalized to the corresponding 18s rRNA (PE ABI, P/N 4308310).
-
bioRxiv - Genetics 2022Quote: ... The F-primer of each microsatellite was labeled with fluorescent dye (6-Fam, Vic, Ned or Pet) and the amplification products were read by ABI 3130xl Fluorescence Reader (Applied Biosystems).
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... using primers and fluorescently labeled probes designed to discriminate alleles using an ABI Prism 7000 real-time PCR system (ABI Assay-by-Design ...
-
bioRxiv - Biochemistry 2019Quote: ... In some experiments we used 6-FAM-labeled DNA and resolved and quantified products using an Applied Biosystems DNA sequencer (ABI 3130xl). Control experiments using radiolabeled DNA established that the 6-FAM label did not alter the kinetics.
-
bioRxiv - Genomics 2020Quote: ... AFP4/TMAC2 (ABI FIVE BINDING PROTEIN 4, AT3G02140), DOG1 (AT5G45830 ...
-
bioRxiv - Genomics 2022Quote: ... were inserted in recombinant plasmid which was sequenced by dideoxy chain termination method with T7 and SP6 primers in an automated sequencer (ABI prism, Chromous Biotech, Bangalore).
-
bioRxiv - Genomics 2021Quote: ... were inserted in recombinant plasmid which was sequenced by dideoxy chain termination method with T7 and SP6 primers in an automated sequencer (ABI prism, Chromous Biotech, Bangalore).
-
bioRxiv - Genetics 2020Quote: ... followed by PCR amplification (ncoa3CRISPR F: FAM-ATGAATGAGCAAGGCCACAT; ncoa3CRIPSR R: GGACTTGCTCCCATTTTAGG) and subjected to fragment length analysis (ABI 3500) to test gRNA efficiency (90% efficiency rate detected) ...
-
bioRxiv - Bioengineering 2021Quote: ... The images were obtained with a system developed in-house consisting of two red LED lamps (610-630 nm, GR-PAR38-12W-R-1, ABI, Indianapolis, IN) for excitation ...
-
bioRxiv - Biochemistry 2019Quote: ... Human CENP-C482-527 fragment (CENP-CCD) (19) and rat CENP-C710-740 (CENP-CCM) (ABI Scientific, Sterling, VA) was added in 2.2-fold or 4-fold molar excess to CENP-A nucleosomes ...
-
bioRxiv - Cancer Biology 2022Quote: ... and Ex-protein fractions using TaqMan microRNA Reverse transcription kit (ABI 4366597 Lot#00636931), TaqMan miRNA stem-loop RT primers/qPCR primer probe set (ABI 4427975) ...
-
bioRxiv - Neuroscience 2022Quote: ... We also used intracellular recordings of human putative L5 parvalbumin (PV, neuron ID: 528687520) interneurons available from ABI (Gouwens et al., 2018). We used reconstructed human neuron morphologies from ABI for the L5 Pyr neuron (Neuron ID ...
-
bioRxiv - Cancer Biology 2019Quote: ... tumor necrosis factor α (TNF-α) and TATA box binding protein (TBP) were determined by real☐time PCR (ABI 7900 Prism, Applied Biosystems, US). Sequences used to amplify a fragment of IL-6 were FP ...