Labshake search
Citations for Drummond Scientific :
1 - 27 of 27 citations for U3 Small Nucleolar RNA Associated Protein 4 Homolog CIRH1A Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... and adeno-associated virus (AAV) particles were injected with a Nanoject 3 (Drummond scientific) at a speed of 1 nl/sec for 30 secs injection with 30 secs pause for a total 33 cycles (i.e. ...
-
bioRxiv - Neuroscience 2022Quote: ... Adeno-associated virus (AAV) was delivered by a glass micropipette using an automated Nanoject III injector (Drummond Scientific, Broomall, PA) following a small craniotomy ...
-
bioRxiv - Neuroscience 2023Quote: ... 100 nl of adeno-associated virus encoding GCaMP8f (AAV-DJ-CAG-FLEx-jGCaMP8f, Janelia Research Campus) was injected with Nanoject III (Drummond Scientific) using thin glass pipette (diameter 30 μm) ...
-
bioRxiv - Neuroscience 2020Quote: ... 200-300 nl solution containing Adeno-Associated Viruses (AAV) was injected in the cortex of each mouse with a Nano injection pump (Nanoject II, Drummond Scientific Company) with a speed of 30 nl/min ...
-
bioRxiv - Neuroscience 2019Quote: ... A small volume (20 – 40 nl) of virus was injected (WTB and KAE: Nanoject II, Drummond Scientific, Broomall ...
-
bioRxiv - Neuroscience 2022Quote: Separated stage IV/V oocytes were injected with 23-4 nL of WT or mutant RNA (Drummond Nanoinject, Drummond Scientific Co., Pennsylvania, USA). Injected oocytes were stored in frog Ringer’s solution (ND96 ...
-
bioRxiv - Neuroscience 2020Quote: ... Injections were performed using a pulled glass pipette (10 –15 μm diameter tip) mounted on a Nanoject II small-volume injector (Drummond Scientific). Each individual injection was performed at a speed of 23 nL/s ...
-
bioRxiv - Neuroscience 2019Quote: ... Unilateral injections were performed using a pulled glass pipette (10-15 μm diameter tip) mounted on a Nanoject II small-volume injector (Drummond Scientific). Approximately 30 nl of virus was deposited at each injection site at 1-2 minute intervals (from bregma in mm ...
-
bioRxiv - Neuroscience 2023Quote: ... were performed using a pulled glass pipette (10–15 µm diameter tip) mounted on a Nanoject II small-volume injector (Drummond Scientific). Injections were performed at a speed of 23 nl/s ...
-
bioRxiv - Neuroscience 2020Quote: ... Virus was introduced through a small craniotomy (from bregma: x=−3, y=−0.9, z=−0.5 mm) using a Nanoject II (Drummond Scientific Company; Broomall, PA) in isoflurane anesthetized mice at P15-17 ...
-
bioRxiv - Neuroscience 2022Quote: ... Viruses were injected using a glass micropipette with a tip diameter of 15-20 μm through a small skull opening (< 0.5 mm2) with a micro-injector (Nanoject3, Drummond Scientific Co., Broomall, USA). Stereotaxic coordinates for auditory cortex (ACx) ...
-
bioRxiv - Neuroscience 2024Quote: ... Viruses were injected using a glass electrode with a tip diameter of 20–25 µm via a small skull opening (<0.4 mm2) with a micro-injector (Nanoject3, Drummond Scientific Co., Broomall, United States). Viruses were diluted to 1.0 × 1013 or 6.0 × 1012 vg/mL ...
-
bioRxiv - Physiology 2022Quote: ... to a concentration of 0.1 mM and slowly injected into the head of the fly in a small aliquot (∼ 14-15 nL) using a Nanoject II Auto-Nanoliter Injector (Drummond Scientific Company, Broomall, PA, USA). Following injection we measured the latency to the first SD event (there were often multiple events following the first one ...
-
bioRxiv - Physiology 2023Quote: ... blood was collected from a small incision in the vena cava using a capillary tube (Hemato-Clad™, Drummond Scientific Company, #1-00-7500-HC/5, Broomall, PA). Each blood sample was immediately placed into a heparin/lithium-coated tube (Beckman Coulter #652825 ...
-
bioRxiv - Neuroscience 2023Quote: ... N=4) at 27.6 nL/min using a nanoliter injector (Nanoject II, Drummond Scientific) at 0.1 Hz ...
-
bioRxiv - Neuroscience 2022Quote: ... The oocytes were microinjected with 4□ng cRNA per oocyte with a Nanoject microinjector (Drummond Scientific Company). The oocytes were kept at 19°C for 3 days in Kulori medium prior to experiments ...
-
bioRxiv - Neuroscience 2023Quote: ... Approximately 200-300 nl of virus was injected over 4-6 minutes using a Nanoject II injector (Drummond Scientific). This injection coordinates primarily label the interposed nucleus of the deep cerebellar nuclei ...
-
bioRxiv - Cell Biology 2020Quote: ... the embryos were collected and injected with 3.5 ng of either control morpholino oligo or with shank3a (AGAAAGTCTTGCGCTCTCACCTGGA) and/or shank3b (AGAAGCATCTCTCGTCACCTGAGGT) targeting morpholino oligos 55 into 1-4 cell stage embryos using Nanoject II microinjector (Drummond Scientific). To study the effects of shank3 mutations ...
-
bioRxiv - Cell Biology 2022Quote: ... 2.3 nl of solutions was injected into 1-4 cell stage zebrafish embryos of casper line using Nanoject II microinjector (Drummond Scientific). After injection ...
-
bioRxiv - Neuroscience 2022Quote: ... They were then subjected to an injection into the thorax with 32 nl heat-killed Staphylococcus aureus NCTC8325-4 (BAC) or PBS using a microinjector (Nanoject II; from Drummond Scientific).
-
bioRxiv - Microbiology 2023Quote: ... re-suspended in water was injected into the thorax of cold-anesthetized 3-4 day old female mosquitoes using a Nanoject III (Drummond Scientific).
-
bioRxiv - Microbiology 2021Quote: ... gambiae female mosquitoes (3-4 d old) were cold-anesthetized and inoculated intrathoracically with 69 nl of dsRNA using a nano-injector (Nanoject, Drummond Scientific, USA). Mosquitoes were maintained at 19 °C for 3 d before infecting with a blood meal ...
-
bioRxiv - Biophysics 2019Quote: ... Actin in fiber bundles was decorated with the resulting BSL-RLC-HMM complex by circulating protein samples through a 25 μL glass capillary (Drummond Scientific) containing a tied fiber bundle.
-
bioRxiv - Molecular Biology 2022Quote: ... Oocytes were injected with 50 nL (12.5 ng of each injected gene) of the desired cRNA subunit and accessory protein combination mix with the NanojectII (Drummond Scientific, USA). Following injection ...
-
bioRxiv - Physiology 2024Quote: ... AedaeItp-l or control Egfp (enhanced green fluorescent protein) dsRNA using a Nanoject III Programmable Nanoliter Injector (Drummond Scientific, Broomall, PA, USA).
-
bioRxiv - Biochemistry 2022Quote: ... Double-stranded RNA (0.4 µg) was injected into the mosquitoes’ thorax with the help of a microinjector (Drummond Scientific). A blood-meal was provided 24 hours after dsRNA injection ...
-
bioRxiv - Biochemistry 2022Quote: Sexually mature females (3 or 4 days old) were anaesthetized (Inject+matic sleeper TAS, Geneva, Switzerland) and injected (Nanoject II, Drummond Scientific/Olinto Martelli Srl, Florence, Italy) with 0.69μg (2x 69nL x 5μg/μL ...