Labshake search
Citations for Drummond Scientific :
1 - 21 of 21 citations for Rat T Cell Surface Glycoprotein CD8 Beta Chain CD8B ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... DV: 2.0 mm from skull surface) using a microinjector (Nanoject 3000, Drummond Scientific). Optic fibers (SFLC230-10 ...
-
bioRxiv - Neuroscience 2023Quote: ... DV −5.1 - 5.4 mm from the cortical surface) using Nanoject II (Drummond Scientific) via a micropipette followed by an optic fiber (200 µm in diameter ...
-
bioRxiv - Neuroscience 2022Quote: ... DV: 1.0 relative to brain surface) using a microinjector (Nanoject 3000, Drummond Scientific) at a rate of 1 nL/s.
-
bioRxiv - Neuroscience 2023Quote: ... DV −2.7-3.3 mm from the cortical surface) using Nanoject II (Drummond Scientific) via a micropipette followed by an optic fiber (400 µm in diameter ...
-
bioRxiv - Neuroscience 2019Quote: ... DV: −3.70 – 3.10 mm from skull surface) using a microinjector (Nanoject 3000, Drummond Scientific). For pathway specific open field experiments ...
-
bioRxiv - Neuroscience 2021Quote: ... siRNA complexes were introduced at multiple points between 700-250 μm below the surface of the brain using a Nanoject-2 (Drummond Scientific), culminating in a total injection volume of 10 μl per hemisphere ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... were performed 1.1 mm deep from the skull surface using a pulled glass capillary (30-50 µm tip diameter PCR micropipette, Drummond Scientific Company) mounted on a hydraulic micromanipulator MO-10 (Narashige ...
-
bioRxiv - Neuroscience 2023Quote: ... DV: -4.5 mm from brain surface) using either a Hamilton syringe (5 µL) or Nanoject (Drummond Scientific; Part number: 3-000-207).
-
bioRxiv - Neuroscience 2021Quote: ... 0.6 mm rostral to bregma and 0.6 mm from the cortical surface) via pulled glass pipettes (5 μl, Drummond Scientific; 10-20 nl/min) using an automated injection system (Model Picospritzer iii ...
-
bioRxiv - Neuroscience 2024Quote: Concentrated GFP+ MGE cells (∼600 cells per nl) were injected using 30° beveled glass micropipettes (80 μm diameter tip, Witerol 5 μl, Drummond Scientific) prefilled with mineral oil into cortex or hippocampus of recipient pup (P2-4) ...
-
bioRxiv - Neuroscience 2019Quote: ... 150 nL per injection for 120-200K cells total injected) through a beveled Drummond glass micropipette (Drummond Scientific) positioned at 45 degrees from vertical ...
-
bioRxiv - Neuroscience 2020Quote: ... Concentrated cell suspensions were loaded into beveled glass micropipettes (≈70-90 μm diameter, Wiretrol 5 μl, Drummond Scientific Company) prefilled with mineral oil and mounted on a microinjector ...
-
bioRxiv - Neuroscience 2023Quote: ... This concentrated cell suspension was loaded into beveled glass micropipettes (~60-100 μm diameter, Wiretrol 5 μL, Drummond Scientific Company) prefilled with mineral oil and mounted on a microinjector as previously described (Wichterle et al. ...
-
bioRxiv - Neuroscience 2020Quote: Transduction of neurons in rat hippocampal slice cultures was achieved by injecting concentrated viral particles into the CA1 pyramidal cell layer on DIV 1 or DIV 2 using a Nanoject II device (Drummond Scientific) (Krüger et al. ...
-
bioRxiv - Neuroscience 2020Quote: Transduction of neurons in hippocampal slice cultures was achieved by injecting concentrated viral particles into the CA1 pyramidal cell layer on DIV 1 or DIV 2 using a Nanoject II device (Drummond Scientific).
-
bioRxiv - Cell Biology 2020Quote: ... the embryos were collected and injected with 3.5 ng of either control morpholino oligo or with shank3a (AGAAAGTCTTGCGCTCTCACCTGGA) and/or shank3b (AGAAGCATCTCTCGTCACCTGAGGT) targeting morpholino oligos 55 into 1-4 cell stage embryos using Nanoject II microinjector (Drummond Scientific). To study the effects of shank3 mutations ...
-
bioRxiv - Cell Biology 2022Quote: ... 2.3 nl of solutions was injected into 1-4 cell stage zebrafish embryos of casper line using Nanoject II microinjector (Drummond Scientific). After injection ...
-
bioRxiv - Cell Biology 2023Quote: ... WM983B cells of different lysosome clustering status (spread, clustered) were injected with a Nanoject II Auto-Nanoliter Injector (Drummond Scientific Company) and microforged glass capillaries (25 to 30µm inner diameter ...
-
bioRxiv - Physiology 2022Quote: ... were co-microinjected into one- or two-cell-stage embryos (4.6 nL/embryo) using the Drummond Nanoject injector (Drummond Scientific, Broomall, PA). The embryos were sampled after 24 h for high-resolution melt analysis (HRMA ...
-
bioRxiv - Developmental Biology 2022Quote: ... were co-microinjected (4.6 nL) into zebrafish embryos at one- or two-cell-stage using the Drummond Nanoject injector (Drummond Scientific, Broomall, PA).
-
bioRxiv - Developmental Biology 2020Quote: ... a single GFP-positive cell was collected from the host node (see ‘single cell manipulation’ below) and then transferred using a micropipette made from a pulled 50 μl calibrated micropipette (Drummond Scientific, Cat 2-000-050) attached to an aspirator tube ...