Labshake search
Citations for Drummond Scientific :
1 - 50 of 50 citations for Rat Nuclear Factor Of Activated T Cells 5 NFAT5 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: Concentrated GFP+ MGE cells (∼600 cells per nl) were injected using 30° beveled glass micropipettes (80 μm diameter tip, Witerol 5 μl, Drummond Scientific) prefilled with mineral oil into cortex or hippocampus of recipient pup (P2-4) ...
-
bioRxiv - Neuroscience 2020Quote: ... Concentrated cell suspensions were loaded into beveled glass micropipettes (≈70-90 μm diameter, Wiretrol 5 μl, Drummond Scientific Company) prefilled with mineral oil and mounted on a microinjector ...
-
bioRxiv - Neuroscience 2023Quote: ... This concentrated cell suspension was loaded into beveled glass micropipettes (~60-100 μm diameter, Wiretrol 5 μL, Drummond Scientific Company) prefilled with mineral oil and mounted on a microinjector as previously described (Wichterle et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... glass micropipettes (Drummond Scientific, 5-000-1001-X10), as previously described (Mohan et al. ...
-
bioRxiv - Neuroscience 2023Quote: Glass pipettes (Wiretrol II, Drummond Scientific Company, 5-000-2010) with a long taper (more than 6 mm ...
-
bioRxiv - Neuroscience 2023Quote: ... connected to a glass pipette (Drummond Scientific, 5-000-2005) pulled to a 30 µm tip (Sutter Instrument ...
-
bioRxiv - Neuroscience 2023Quote: ... A Wiretrol II glass pipette (Drummond Scientific Company, 5-0002010), pulled to give a sharp tip (Sutter ...
-
bioRxiv - Neuroscience 2023Quote: ... and pulled glass electrodes (Drummond Scientific Company, 5-000-2005). 400 nl of virus was injected at a rate of 40 nl/min ...
-
bioRxiv - Bioengineering 2023Quote: Glass pipettes (5-000-1010, DRUMMOND WIRETROL, Drummond Scientific Co.) were pulled on a Model P-97 (Sutter Instrument Co.) ...
-
bioRxiv - Neuroscience 2022Quote: ... A calibrated glass pipette (calibrated micropipette 1-5 µl, Drummond Scientific) filled with the appropriate virus was slowly lowered to the target depth of 2.9 mm below bregma ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 sec delay between 10 nl injection cycles (Nanoject III, Drummond Scientific) using pulled glass pipets (Drummond Scientific) ...
-
bioRxiv - Developmental Biology 2020Quote: ... on ice and then aspirated into a micropipette (Drummond Scientific, 5-000-2010). A small incision was made near the kidney pole to separate the capsule from the renal parenchyma ...
-
bioRxiv - Neuroscience 2020Quote: ... and ITC injections (marked 1 to 5 μl, Drummond Scientific, Broomall, PA, USA) were pulled on a horizontal pipette puller (P-1000 ...
-
bioRxiv - Neuroscience 2024Quote: ... and a beveled glass pipette (Wiretrol II, 5-000-2010, Drummond Scientific Company) back-filled with mineral oil and front-filled with the material to be injected was slowly inserted into a target coordinate ...
-
bioRxiv - Neuroscience 2019Quote: ... Viruses were front-filled into a pulled glass pipette (Drummond Scientific, #5-000-2005) filled with mineral oil (Millipore Sigma ...
-
bioRxiv - Neuroscience 2020Quote: ... using a pulled glass pipette (5 μl PCR Pipets, Drummond Scientific Co, Broomall, PA, USA) attached to a Hamilton microliter syringe (Hamilton Bonaduz AG ...
-
bioRxiv - Neuroscience 2020Quote: ... and a glass pipette (Wiretrol II #5-000-2005, Drummond Scientific Company, Broomall, PA, USA), pulled to have an outer diameter of 60-90μm at the tip ...
-
bioRxiv - Developmental Biology 2021Quote: ... glass needles were created by pulling Wiretrol II capillaries (Drummond Scientific Company, cat. #5-000-2005) using a needle puller (Sutter Instrument ...
-
bioRxiv - Plant Biology 2021Quote: ... (2) A ∼5 cm (15 µL capacity) glass capillary tube (Drummond Scientific, Cat# 1-1000-0150) was inserted in the 2 mm perforation such that the bottom of the tube reaches the 500 µl mark when the lid is refastened to the Eppendorf tube ...
-
bioRxiv - Neuroscience 2023Quote: ... The virus solution was sucked into a glass capillary (calibrated micropipette 1-5 µl, Drummond Scientific) that was gently lowered to the target depth ...
-
bioRxiv - Neuroscience 2023Quote: ... dorsal-ventral (D/V): 2] using a glass micropipette (Drummond Scientific Company, Wiretrol I, 5-000-1050) was performed ...
-
bioRxiv - Genetics 2019Quote: ... Cold-anesthetized 5-6 day-old females were injected into their thorax using a nanoinjector (Nanoject II, Drummond Scientific) with 69 nL of bacteria or 138 nL of fluorescent beads ...
-
bioRxiv - Immunology 2021Quote: Phagocytosis assays were performed by injecting 69 nl of 2% green fluorescent FluoSpheres (vol/vol) in 1X PBS to naïve female mosquitoes (3-to 5-day old) using a Nanoject II injector (Drummond Scientific). After injection ...
-
bioRxiv - Neuroscience 2022Quote: ... 104487-AAV1) with titers of 1-5×1012 in dorsal dentate gyrus using a Nanoject syringe (Drummond Scientific, Broomall, PA). Unilateral injection coordinates for dorsal DG were -2 mm AP ...
-
bioRxiv - Microbiology 2023Quote: Nectar was extracted from each flower within 24 h of collection from the field using microcapillary tubes (0.5 and 1-5 µL, Drummond Scientific). For each site and cultivar ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV viruses containing double floxed ChR2 construct (5 nl) were microinjected to the septal tissue with a micro injector (Drummond Scientific) on the second day of culturing ...
-
bioRxiv - Neuroscience 2021Quote: ... at 3 to 5 sites (1-2 μl; 1E13 GC/ml) through a beveled glass micropipette (15 to 25 μm tip diameter, Drummond Scientific) using a pressure injector (Drummond Nanoject II) ...
-
bioRxiv - Neuroscience 2024Quote: ... Zürich) at an injection rate of 50-100 nL/min using a thin glass pipette (5-000-1001-X, Drummond Scientific) pulled on a vertical puller (Narishige PP-830) ...
-
bioRxiv - Neuroscience 2021Quote: ... purchased from Addgene (viral prep #100843-AAV1) with titer of 1-5×1012 in dorsal dentate gyrus using a Nanoject syringe (Drummond Scientific, Broomall, PA). Injection coordinates were −1.5 mm AP ...
-
bioRxiv - Immunology 2019Quote: ... was injected into the thorax or abdomen of anesthetized females aged 5-7 days using a Nanoject II injector (Drummond Scientific Inc.) fitted with a pulled glass capillary ...
-
bioRxiv - Neuroscience 2022Quote: ... Injections (0.75 ul/hemisphere) were performed over a period of 5 minutes (0.15 ul/minute) using a Nanoject II (Drummond Scientific, Broomall, PA) and injectors were left in place for 5 minutes to facilitate viral diffusion from the injection site ...
-
bioRxiv - Molecular Biology 2022Quote: ... Oocytes were injected with 50 nL (12.5 ng of each injected gene) of the desired cRNA subunit and accessory protein combination mix with the NanojectII (Drummond Scientific, USA). Following injection ...
-
bioRxiv - Neuroscience 2023Quote: ... DV: -4.5 mm from brain surface) using either a Hamilton syringe (5 µL) or Nanoject (Drummond Scientific; Part number: 3-000-207).
-
bioRxiv - Neuroscience 2024Quote: ... Virus was injected bilaterally in the DMS or DLS at 4.6 nL/5 seconds (9 minutes) using a borosilicate pipette (Drummond scientific, >25 µm) coupled to a nanoinjector (Nanoject II Drummond Scientific) ...
-
bioRxiv - Neuroscience 2022Quote: ... The skull was gently drilled and 10 nL of a viral solution were injected (Nanoject III, Drummond Scientific, rate of 5 nL/min) at a depth of 1.25 mm below the dura.
-
bioRxiv - Neuroscience 2024Quote: ... Mice were head-fixed on a platform and the B2 whisker was inserted inside a glass capillary tube (Wiretrol® II 5 & 10 uL, Drummond Scientific Company) placed 2mm away from the mouse’s snout ...
-
bioRxiv - Neuroscience 2022Quote: ... Ten nL of undiluted viral solution were injected using an oil-based pressure injection system (Nanoject III, Drummond Scientific, rate of 5 nL/min). The tip of the pipette was broken to achieve an opening with an internal diameter of 30-40 μm ...
-
bioRxiv - Neuroscience 2021Quote: ... 0.6 mm rostral to bregma and 0.6 mm from the cortical surface) via pulled glass pipettes (5 μl, Drummond Scientific; 10-20 nl/min) using an automated injection system (Model Picospritzer iii ...
-
bioRxiv - Neuroscience 2020Quote: ... filled with an AAV vector without dilution (qPCR titer: 3–5×10^12 vg/ml) was installed with an auto-nanoliter injector (Nanoject II; Drummond Scientific, Broomall, PA, USA) and the injector was 9.5 degree leftward tilled from the sagittal plane to avoid the sagittal sinus ...
-
bioRxiv - Neuroscience 2019Quote: ... Pseudo-stereotaxic injection (from lambda ML: −1,2, A/P:2, D/V: 2,5-2) using glass micropipette (Drummond scientific company, wiretol I 50μL, 5-000-1050) was performed and 2μL of plasmid (betweeen 5 and 8 μg/μL ...
-
bioRxiv - Physiology 2023Quote: ... blood was collected from a small incision in the vena cava using a capillary tube (Hemato-Clad™, Drummond Scientific Company, #1-00-7500-HC/5, Broomall, PA). Each blood sample was immediately placed into a heparin/lithium-coated tube (Beckman Coulter #652825 ...
-
bioRxiv - Neuroscience 2019Quote: ... 150 nL per injection for 120-200K cells total injected) through a beveled Drummond glass micropipette (Drummond Scientific) positioned at 45 degrees from vertical ...
-
bioRxiv - Neuroscience 2020Quote: Transduction of neurons in rat hippocampal slice cultures was achieved by injecting concentrated viral particles into the CA1 pyramidal cell layer on DIV 1 or DIV 2 using a Nanoject II device (Drummond Scientific) (Krüger et al. ...
-
bioRxiv - Neuroscience 2020Quote: Transduction of neurons in hippocampal slice cultures was achieved by injecting concentrated viral particles into the CA1 pyramidal cell layer on DIV 1 or DIV 2 using a Nanoject II device (Drummond Scientific).
-
bioRxiv - Cell Biology 2020Quote: ... the embryos were collected and injected with 3.5 ng of either control morpholino oligo or with shank3a (AGAAAGTCTTGCGCTCTCACCTGGA) and/or shank3b (AGAAGCATCTCTCGTCACCTGAGGT) targeting morpholino oligos 55 into 1-4 cell stage embryos using Nanoject II microinjector (Drummond Scientific). To study the effects of shank3 mutations ...
-
bioRxiv - Cell Biology 2022Quote: ... 2.3 nl of solutions was injected into 1-4 cell stage zebrafish embryos of casper line using Nanoject II microinjector (Drummond Scientific). After injection ...
-
bioRxiv - Cell Biology 2023Quote: ... WM983B cells of different lysosome clustering status (spread, clustered) were injected with a Nanoject II Auto-Nanoliter Injector (Drummond Scientific Company) and microforged glass capillaries (25 to 30µm inner diameter ...
-
bioRxiv - Physiology 2022Quote: ... were co-microinjected into one- or two-cell-stage embryos (4.6 nL/embryo) using the Drummond Nanoject injector (Drummond Scientific, Broomall, PA). The embryos were sampled after 24 h for high-resolution melt analysis (HRMA ...
-
bioRxiv - Developmental Biology 2022Quote: ... were co-microinjected (4.6 nL) into zebrafish embryos at one- or two-cell-stage using the Drummond Nanoject injector (Drummond Scientific, Broomall, PA).
-
bioRxiv - Developmental Biology 2020Quote: ... a single GFP-positive cell was collected from the host node (see ‘single cell manipulation’ below) and then transferred using a micropipette made from a pulled 50 μl calibrated micropipette (Drummond Scientific, Cat 2-000-050) attached to an aspirator tube ...