Labshake search
Citations for Drummond Scientific :
1 - 13 of 13 citations for Primary Human Cell since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... mosquitoes were injected in the thorax with 414nl of 10mM 2HPCD (this concentration was chosen in line with previously published in vivo experiments in mice and humans (48,49) using Nanoject II (Drummond Scientific, Pennsylvania, USA) hand-held microinjector ...
-
bioRxiv - Neuroscience 2024Quote: Concentrated GFP+ MGE cells (∼600 cells per nl) were injected using 30° beveled glass micropipettes (80 μm diameter tip, Witerol 5 μl, Drummond Scientific) prefilled with mineral oil into cortex or hippocampus of recipient pup (P2-4) ...
-
bioRxiv - Neuroscience 2019Quote: ... 150 nL per injection for 120-200K cells total injected) through a beveled Drummond glass micropipette (Drummond Scientific) positioned at 45 degrees from vertical ...
-
bioRxiv - Neuroscience 2020Quote: ... Concentrated cell suspensions were loaded into beveled glass micropipettes (≈70-90 μm diameter, Wiretrol 5 μl, Drummond Scientific Company) prefilled with mineral oil and mounted on a microinjector ...
-
bioRxiv - Neuroscience 2023Quote: ... This concentrated cell suspension was loaded into beveled glass micropipettes (~60-100 μm diameter, Wiretrol 5 μL, Drummond Scientific Company) prefilled with mineral oil and mounted on a microinjector as previously described (Wichterle et al. ...
-
bioRxiv - Neuroscience 2020Quote: Transduction of neurons in rat hippocampal slice cultures was achieved by injecting concentrated viral particles into the CA1 pyramidal cell layer on DIV 1 or DIV 2 using a Nanoject II device (Drummond Scientific) (Krüger et al. ...
-
bioRxiv - Neuroscience 2020Quote: Transduction of neurons in hippocampal slice cultures was achieved by injecting concentrated viral particles into the CA1 pyramidal cell layer on DIV 1 or DIV 2 using a Nanoject II device (Drummond Scientific).
-
bioRxiv - Cell Biology 2020Quote: ... the embryos were collected and injected with 3.5 ng of either control morpholino oligo or with shank3a (AGAAAGTCTTGCGCTCTCACCTGGA) and/or shank3b (AGAAGCATCTCTCGTCACCTGAGGT) targeting morpholino oligos 55 into 1-4 cell stage embryos using Nanoject II microinjector (Drummond Scientific). To study the effects of shank3 mutations ...
-
bioRxiv - Cell Biology 2022Quote: ... 2.3 nl of solutions was injected into 1-4 cell stage zebrafish embryos of casper line using Nanoject II microinjector (Drummond Scientific). After injection ...
-
bioRxiv - Cell Biology 2023Quote: ... WM983B cells of different lysosome clustering status (spread, clustered) were injected with a Nanoject II Auto-Nanoliter Injector (Drummond Scientific Company) and microforged glass capillaries (25 to 30µm inner diameter ...
-
bioRxiv - Physiology 2022Quote: ... were co-microinjected into one- or two-cell-stage embryos (4.6 nL/embryo) using the Drummond Nanoject injector (Drummond Scientific, Broomall, PA). The embryos were sampled after 24 h for high-resolution melt analysis (HRMA ...
-
bioRxiv - Developmental Biology 2022Quote: ... were co-microinjected (4.6 nL) into zebrafish embryos at one- or two-cell-stage using the Drummond Nanoject injector (Drummond Scientific, Broomall, PA).
-
bioRxiv - Developmental Biology 2020Quote: ... a single GFP-positive cell was collected from the host node (see ‘single cell manipulation’ below) and then transferred using a micropipette made from a pulled 50 μl calibrated micropipette (Drummond Scientific, Cat 2-000-050) attached to an aspirator tube ...