Labshake search
Citations for Drummond Scientific :
1 - 15 of 15 citations for Neural Precursor Cell Expressed Developmentally Down Regulated 9 NEDD9 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2023Quote: ... The solution was injected into the thorax using glass capillaries (9 cm x 1.14mm diameter, Drummond Scientific, Broomall, PA) on ice ...
-
bioRxiv - Developmental Biology 2020Quote: ... the tissue was gently aspirated up and down using a micropipette (made from a pulled 50 μl calibrated micropipette (Drummond Scientific, Cat 2-000-050) attached to an aspirator tube) ...
-
bioRxiv - Neuroscience 2024Quote: ... Virus was injected bilaterally in the DMS or DLS at 4.6 nL/5 seconds (9 minutes) using a borosilicate pipette (Drummond scientific, >25 µm) coupled to a nanoinjector (Nanoject II Drummond Scientific) ...
-
bioRxiv - Neuroscience 2024Quote: Concentrated GFP+ MGE cells (∼600 cells per nl) were injected using 30° beveled glass micropipettes (80 μm diameter tip, Witerol 5 μl, Drummond Scientific) prefilled with mineral oil into cortex or hippocampus of recipient pup (P2-4) ...
-
bioRxiv - Neuroscience 2019Quote: ... 150 nL per injection for 120-200K cells total injected) through a beveled Drummond glass micropipette (Drummond Scientific) positioned at 45 degrees from vertical ...
-
bioRxiv - Neuroscience 2020Quote: ... Concentrated cell suspensions were loaded into beveled glass micropipettes (≈70-90 μm diameter, Wiretrol 5 μl, Drummond Scientific Company) prefilled with mineral oil and mounted on a microinjector ...
-
bioRxiv - Neuroscience 2023Quote: ... This concentrated cell suspension was loaded into beveled glass micropipettes (~60-100 μm diameter, Wiretrol 5 μL, Drummond Scientific Company) prefilled with mineral oil and mounted on a microinjector as previously described (Wichterle et al. ...
-
bioRxiv - Neuroscience 2020Quote: Transduction of neurons in rat hippocampal slice cultures was achieved by injecting concentrated viral particles into the CA1 pyramidal cell layer on DIV 1 or DIV 2 using a Nanoject II device (Drummond Scientific) (Krüger et al. ...
-
bioRxiv - Neuroscience 2020Quote: Transduction of neurons in hippocampal slice cultures was achieved by injecting concentrated viral particles into the CA1 pyramidal cell layer on DIV 1 or DIV 2 using a Nanoject II device (Drummond Scientific).
-
bioRxiv - Cell Biology 2020Quote: ... the embryos were collected and injected with 3.5 ng of either control morpholino oligo or with shank3a (AGAAAGTCTTGCGCTCTCACCTGGA) and/or shank3b (AGAAGCATCTCTCGTCACCTGAGGT) targeting morpholino oligos 55 into 1-4 cell stage embryos using Nanoject II microinjector (Drummond Scientific). To study the effects of shank3 mutations ...
-
bioRxiv - Cell Biology 2022Quote: ... 2.3 nl of solutions was injected into 1-4 cell stage zebrafish embryos of casper line using Nanoject II microinjector (Drummond Scientific). After injection ...
-
bioRxiv - Cell Biology 2023Quote: ... WM983B cells of different lysosome clustering status (spread, clustered) were injected with a Nanoject II Auto-Nanoliter Injector (Drummond Scientific Company) and microforged glass capillaries (25 to 30µm inner diameter ...
-
bioRxiv - Physiology 2022Quote: ... were co-microinjected into one- or two-cell-stage embryos (4.6 nL/embryo) using the Drummond Nanoject injector (Drummond Scientific, Broomall, PA). The embryos were sampled after 24 h for high-resolution melt analysis (HRMA ...
-
bioRxiv - Developmental Biology 2022Quote: ... were co-microinjected (4.6 nL) into zebrafish embryos at one- or two-cell-stage using the Drummond Nanoject injector (Drummond Scientific, Broomall, PA).
-
bioRxiv - Developmental Biology 2020Quote: ... a single GFP-positive cell was collected from the host node (see ‘single cell manipulation’ below) and then transferred using a micropipette made from a pulled 50 μl calibrated micropipette (Drummond Scientific, Cat 2-000-050) attached to an aspirator tube ...