Labshake search
Citations for Drummond Scientific :
1 - 45 of 45 citations for AMPK alpha 1 Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... A small hole was drilled into the skull and 400 nL of 0.9% saline or 0.9% saline + 100 ng/μL recombinant mouse IFN-γ (40 ng IFN-γ total) was injected through a pulled glass pipet using a Nanoject 2000 (Drummond Scientific; 8 pulses of 50 nL). At 5 minutes after injection ...
-
bioRxiv - Microbiology 2023Quote: ... 1-μl capillaries (Microcaps, Drummond Scientific) were heat-sealed at one end and filled with buffer (control ...
-
bioRxiv - Neuroscience 2022Quote: ... VVF ETH Zurich) 1:1 in sterile saline and loaded it into a Nanoject II or Nanoject III injector (Drummond Scientific). After induction of anesthesia as described above ...
-
bioRxiv - Molecular Biology 2020Quote: ... Oocytes were injected with 27-54 ng of total mRNA for α, β and γ subunits in a 1:1:10 ratio (Boileau et al., 2002) (Nanoject, Drummond Scientific). Oocytes were incubated in ND96 (in mM ...
-
bioRxiv - Biophysics 2023Quote: ... Oocytes were injected with 27–54 ng of total mRNA for α, β, and γ subunits (or mutants) in a 1:1:10 ratio (Boileau et al., 2002) (Nanoject, Drummond Scientific). Oocytes were incubated in ND96 (in mM ...
-
bioRxiv - Developmental Biology 2020Quote: ... diluted 1:100 in PBS using a Nanoject injector (Drummond Scientific). After injection ...
-
bioRxiv - Neuroscience 2022Quote: ... A calibrated glass pipette (calibrated micropipette 1-5 µl, Drummond Scientific) filled with the appropriate virus was slowly lowered to the target depth of 2.9 mm below bregma ...
-
bioRxiv - Neuroscience 2020Quote: ... and ITC injections (marked 1 to 5 μl, Drummond Scientific, Broomall, PA, USA) were pulled on a horizontal pipette puller (P-1000 ...
-
bioRxiv - Neuroscience 2022Quote: ... through a glass pipette (PCR Micropipets 1 – 10 ml, Drummond Scientific Company, USA) with a 21 – 27 µm inner tip diameter ...
-
bioRxiv - Neuroscience 2022Quote: ... Injections were done at 1 nL/s with a Nanoject III (Drummond Scientific Company).
-
The Indirect Pathway of the Basal Ganglia Promotes Negative Reinforcement, But Not Motor SuppressionbioRxiv - Neuroscience 2022Quote: ... Virus (Striatum: 0.5-1 μl, GPe: 150 nL) was injected with a Nanoject (Drummond Scientific) through a pulled glass pipet (tip diameter ∼30 μm ...
-
bioRxiv - Plant Biology 2021Quote: ... (2) A ∼5 cm (15 µL capacity) glass capillary tube (Drummond Scientific, Cat# 1-1000-0150) was inserted in the 2 mm perforation such that the bottom of the tube reaches the 500 µl mark when the lid is refastened to the Eppendorf tube ...
-
bioRxiv - Neuroscience 2023Quote: ... The virus solution was sucked into a glass capillary (calibrated micropipette 1-5 µl, Drummond Scientific) that was gently lowered to the target depth ...
-
bioRxiv - Neuroscience 2021Quote: ... Viruses were delivered at a rate of 1-2 nl/s using Nanoject III (Drummond Scientific, USA).
-
bioRxiv - Neuroscience 2022Quote: ... Viruses were delivered at a rate of 1–2 nl/s using Nanoject III (Drummond Scientific, USA). Viruses were injected at three cortical depths covering all layers of the VISp and SSp-bfd ...
-
bioRxiv - Developmental Biology 2024Quote: Animals were injected with zfp-1 dsRNA using Nanoject III (CAT 3-000-207, Drummond Scientific company). Briefly ...
-
bioRxiv - Neuroscience 2022Quote: ... DV: −4.5 mm relative to bregma) at 1 nl/s with a Nanoject III microinjector (Drummond Scientific, PA). Custom-made optic fibers (0.22NA ...
-
bioRxiv - Neuroscience 2023Quote: ... Glass needles were made from 1-mm outer diameter glass pipettes (Wiretrol II, Drummond Scientific Company, Broomall, PA) pulled to a fine tip (20 - 50 µm tip diameter ...
-
bioRxiv - Neuroscience 2021Quote: ... The virus was injected with a bevelled micropipette using a Nanoject II injector (Drummond Scientific Company, Broomall, PA 1) attached to a stereotaxic micromanipulator ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV9.hSyn.DIO.eGFP.WPRE.hGH was injected into the lower thoracic spinal cord through the intervertebral space of P7 or P8 GdnfTom mice (100 nL total in 27.6 nL increments at 1-2 min intervals (Nanoject II, Drummond Scientific), 1.07 x 1013 GC/mL ...
-
bioRxiv - Cancer Biology 2021Quote: ... PB samples (∼100 μl per mouse) were collected in EDTA-coated capillary tube (Drummond Scientific, cat.no. 1-000-800/12) by submandibular venipuncture with 5-mm Goldenrod animal lancets (Braintree Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... 104487-AAV1) with titers of 1-5×1012 in dorsal dentate gyrus using a Nanoject syringe (Drummond Scientific, Broomall, PA). Unilateral injection coordinates for dorsal DG were -2 mm AP ...
-
bioRxiv - Microbiology 2023Quote: Nectar was extracted from each flower within 24 h of collection from the field using microcapillary tubes (0.5 and 1-5 µL, Drummond Scientific). For each site and cultivar ...
-
bioRxiv - Genetics 2019Quote: ... was injected into the thorax of cold-anesthetized 1 d-old female mosquitoes using a Nanoject II Auto-Nanoliter Injector (Drummond Scientific). Mosquitoes were injected with dsRNA specific for the target gene ...
-
bioRxiv - Neuroscience 2019Quote: ... 100 nL of the 2% DiI solution was then slowly injected into either rostral forelimb motor area (RFA) or caudal forelimb motor area (CFA) at 1 nl/sec (Nanoject III, Drummond Scientific). The coordinates for the RFA and CFA in male Long Evans rats were based on previous reports (Brown and Teskey 2014 ...
-
bioRxiv - Neuroscience 2020Quote: Transduction of neurons in rat hippocampal slice cultures was achieved by injecting concentrated viral particles into the CA1 pyramidal cell layer on DIV 1 or DIV 2 using a Nanoject II device (Drummond Scientific) (Krüger et al. ...
-
bioRxiv - Neuroscience 2020Quote: Transduction of neurons in hippocampal slice cultures was achieved by injecting concentrated viral particles into the CA1 pyramidal cell layer on DIV 1 or DIV 2 using a Nanoject II device (Drummond Scientific).
-
bioRxiv - Evolutionary Biology 2019Quote: ... Virus was delivered at a speed of 46 nl s−1 into the thorax using a pulled glass capillary needle and a manual microinjector (Nanoject II; Drummond Scientific). This controlled the infection dose by removing the variation that would have resulted from oral feeding ...
-
bioRxiv - Cell Biology 2020Quote: ... the embryos were collected and injected with 3.5 ng of either control morpholino oligo or with shank3a (AGAAAGTCTTGCGCTCTCACCTGGA) and/or shank3b (AGAAGCATCTCTCGTCACCTGAGGT) targeting morpholino oligos 55 into 1-4 cell stage embryos using Nanoject II microinjector (Drummond Scientific). To study the effects of shank3 mutations ...
-
bioRxiv - Neuroscience 2021Quote: ... at 3 to 5 sites (1-2 μl; 1E13 GC/ml) through a beveled glass micropipette (15 to 25 μm tip diameter, Drummond Scientific) using a pressure injector (Drummond Nanoject II) ...
-
bioRxiv - Cell Biology 2022Quote: ... 2.3 nl of solutions was injected into 1-4 cell stage zebrafish embryos of casper line using Nanoject II microinjector (Drummond Scientific). After injection ...
-
bioRxiv - Neuroscience 2023Quote: ... then injected into target brain coordinates at the rate of 1 nL per second using a Nanoject III programmable injector (Drummond Scientific). Target brain coordinates (relative to bregma ...
-
bioRxiv - Neuroscience 2023Quote: ... In both cases we used borosilicate glass pipettes connected to a Nanoject II or Nanoject III Programmable Nanoliter Injector (1-3 μL/min, Drummond Scientific). Injections of 69 nL were made every 1 min and after the last injection the pipette was left in place for 2-10 minutes to allow diffusion and was then retracted.
-
bioRxiv - Neuroscience 2021Quote: ... purchased from Addgene (viral prep #100843-AAV1) with titer of 1-5×1012 in dorsal dentate gyrus using a Nanoject syringe (Drummond Scientific, Broomall, PA). Injection coordinates were −1.5 mm AP ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... were performed 1.1 mm deep from the skull surface using a pulled glass capillary (30-50 µm tip diameter PCR micropipette, Drummond Scientific Company) mounted on a hydraulic micromanipulator MO-10 (Narashige ...
-
bioRxiv - Biophysics 2022Quote: ... microinjected with 50 nl of cRNA solution (10 ng for KCNQ1 and 1 ng for KCNE3) using a NANOJECT II (Drummond Scientific Co.), and incubated until use at 18 °C in Barth’s solution (88 mM NaCl ...
-
bioRxiv - Developmental Biology 2023Quote: ... Three doses of 32.2 nl (at 1 mg/mL) were delivered each day using a Nanoject II (Drummond Scientific Broomall, PA, USA). The head and tail of the animal was amputated on the fourth day ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... of purified dsRNA product was injected into the thorax of cold anesthetized 1–2-day old female mosquito using nano-injector (Drummond Scientific, CA, USA). The silencing of the respective gene was confirmed by quantitative RT-PCR after 3-4 -days of dsRNA injection.
-
A testis-specific Heme Peroxidase HPX12 regulates male fertility in the mosquito Anopheles stephensibioRxiv - Animal Behavior and Cognition 2020Quote: ... of purified dsRNA product was injected into the thorax of a cold anesthetized 1–2-day old male mosquito using a nano-injector (Drummond Scientific, CA, USA). The silencing of the respective gene was confirmed by quantitative RT-PCR after 3-4-days of dsRNA injection.
-
bioRxiv - Neuroscience 2022Quote: ... for neuronal Ca2+ detection was mixed with the astrocyte-targeted CalEx encoding construct AAV2/5.GfaABC1D-HA-hPMCA2w/b (1.18 × 1013 gc/ml) in a 1:3 ratio and delivered by a Nanoject III (Drummond Scientific, Broomall, PA, USA) in a volume of 400nL ...
-
bioRxiv - Physiology 2020Quote: ... Injections were performed bilaterally at a rate of 1 nl/sec using a glass pipette connected to a Nanoject III (Drummond Scientific, Broomall, PA). More than 3 weeks after the viral injections ...
-
bioRxiv - Physiology 2021Quote: ... Oocytes were injected with 18.4 ng of ayRhp1 cRNA (36.8 nL with 0.5 ng nl−1) (ayRhp1) or equivalent volume of nuclease-free water (control) using a Nanoject II or III auto-nanoliter injector (Drummond Scientific, Broomall, PA, USA). Experiments were conducted three days post-injection ...
-
bioRxiv - Neuroscience 2023Quote: ... Microinjections were performed with a 1 µL Neuros Hamilton syringe (Hamilton, Reno, NV, USA) and a micro-infusion pump (Nanoject III, Drummond Scientific; Broomall, PA, USA) that infused virus at 100 nL/min ...
-
bioRxiv - Neuroscience 2023Quote: ... at the titer of 1×1012 vg/ml in a total of 150 nl in the aid of nanoliter injector (Nanoject III, Drummond scientific, USA, Catalog #68018).
-
bioRxiv - Physiology 2023Quote: ... blood was collected from a small incision in the vena cava using a capillary tube (Hemato-Clad™, Drummond Scientific Company, #1-00-7500-HC/5, Broomall, PA). Each blood sample was immediately placed into a heparin/lithium-coated tube (Beckman Coulter #652825 ...