Labshake search
Citations for Drummond Scientific :
1 - 39 of 39 citations for 7 Chloro quinazoline 2 4 diamine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... by a Nanoject 2 (Drummond Scientific). Five ...
-
bioRxiv - Immunology 2019Quote: ... was injected into the thorax or abdomen of anesthetized females aged 5-7 days using a Nanoject II injector (Drummond Scientific Inc.) fitted with a pulled glass capillary ...
-
bioRxiv - Neuroscience 2023Quote: ... A pulled glass pipette (2-000-001, Drummond Scientific) filled with AAV vector was slowly lowered into the brain with the help of a micropositioner (Model 2650 ...
-
bioRxiv - Neuroscience 2023Quote: ... N=4) at 27.6 nL/min using a nanoliter injector (Nanoject II, Drummond Scientific) at 0.1 Hz ...
-
bioRxiv - Neuroscience 2019Quote: ... Pseudo-stereotaxic injection (from lambda ML: −1,2, A/P:2, D/V: 2,5-2) using glass micropipette (Drummond scientific company, wiretol I 50μL, 5-000-1050) was performed and 2μL of plasmid (betweeen 5 and 8 μg/μL ...
-
bioRxiv - Genetics 2021Quote: ... Five glass capillaries (Drummond Scientific Company, Cat. No. 2-000-001) were filled with 5 μl of 20% sucrose solution in water and inserted into pipet tips on the cap ...
-
bioRxiv - Neuroscience 2022Quote: ... The oocytes were microinjected with 4□ng cRNA per oocyte with a Nanoject microinjector (Drummond Scientific Company). The oocytes were kept at 19°C for 3 days in Kulori medium prior to experiments ...
-
bioRxiv - Immunology 2021Quote: ... Tears were collected using 2 μL sized Microcaps glass capillaries (Drummond Scientific, Broomall, PA) for 5 min after topical stimulation ...
-
bioRxiv - Neuroscience 2023Quote: ... Approximately 200-300 nl of virus was injected over 4-6 minutes using a Nanoject II injector (Drummond Scientific). This injection coordinates primarily label the interposed nucleus of the deep cerebellar nuclei ...
-
bioRxiv - Neuroscience 2022Quote: ... Virus was infused at a rate of 2 nL/s using a microinjector (Drummond Scientific Company ...
-
bioRxiv - Neuroscience 2021Quote: ... using a vertical micropipette puller (PE-2, Narishige) via an automated injector (Nanoject III, Drummond Scientific). Tracers were injected unilaterally ...
-
bioRxiv - Plant Biology 2021Quote: ... (2) A ∼5 cm (15 µL capacity) glass capillary tube (Drummond Scientific, Cat# 1-1000-0150) was inserted in the 2 mm perforation such that the bottom of the tube reaches the 500 µl mark when the lid is refastened to the Eppendorf tube ...
-
bioRxiv - Cell Biology 2020Quote: ... the embryos were collected and injected with 3.5 ng of either control morpholino oligo or with shank3a (AGAAAGTCTTGCGCTCTCACCTGGA) and/or shank3b (AGAAGCATCTCTCGTCACCTGAGGT) targeting morpholino oligos 55 into 1-4 cell stage embryos using Nanoject II microinjector (Drummond Scientific). To study the effects of shank3 mutations ...
-
bioRxiv - Cell Biology 2022Quote: ... 2.3 nl of solutions was injected into 1-4 cell stage zebrafish embryos of casper line using Nanoject II microinjector (Drummond Scientific). After injection ...
-
bioRxiv - Neuroscience 2022Quote: ... They were then subjected to an injection into the thorax with 32 nl heat-killed Staphylococcus aureus NCTC8325-4 (BAC) or PBS using a microinjector (Nanoject II; from Drummond Scientific).
-
bioRxiv - Microbiology 2023Quote: ... re-suspended in water was injected into the thorax of cold-anesthetized 3-4 day old female mosquitoes using a Nanoject III (Drummond Scientific).
-
bioRxiv - Neuroscience 2021Quote: ... Viruses were delivered at a rate of 1-2 nl/s using Nanoject III (Drummond Scientific, USA).
-
bioRxiv - Neuroscience 2022Quote: ... Viruses were delivered at a rate of 1–2 nl/s using Nanoject III (Drummond Scientific, USA). Viruses were injected at three cortical depths covering all layers of the VISp and SSp-bfd ...
-
bioRxiv - Neuroscience 2022Quote: ... −4.4 DV) at 100nl/min using a glass pipette attached to a microinjector (Nanoject 2, Drummond Scientific). Following viral infusion ...
-
bioRxiv - Neuroscience 2023Quote: ... dorsal-ventral (D/V): 2] using a glass micropipette (Drummond Scientific Company, Wiretrol I, 5-000-1050) was performed ...
-
bioRxiv - Microbiology 2021Quote: ... gambiae female mosquitoes (3-4 d old) were cold-anesthetized and inoculated intrathoracically with 69 nl of dsRNA using a nano-injector (Nanoject, Drummond Scientific, USA). Mosquitoes were maintained at 19 °C for 3 d before infecting with a blood meal ...
-
bioRxiv - Neuroscience 2022Quote: Separated stage IV/V oocytes were injected with 23-4 nL of WT or mutant RNA (Drummond Nanoinject, Drummond Scientific Co., Pennsylvania, USA). Injected oocytes were stored in frog Ringer’s solution (ND96 ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV9.hSyn.DIO.eGFP.WPRE.hGH was injected into the lower thoracic spinal cord through the intervertebral space of P7 or P8 GdnfTom mice (100 nL total in 27.6 nL increments at 1-2 min intervals (Nanoject II, Drummond Scientific), 1.07 x 1013 GC/mL ...
-
bioRxiv - Neuroscience 2020Quote: ... +0.2 and ML: 2.5 and DV: -4.6 & -4.4 relative to bregma using a Nanoject III microinjector (Drummond Scientific, Broomall, PA). 100 µm-core optic fibers (Precision Fiber Products ...
-
bioRxiv - Neuroscience 2022Quote: Injections of 2 mM muscimol in normal saline were performed using the Nanoject III Programmable Nanoliter Injector from Drummond Scientific Company fitted with a borosilicate glass micropipette ...
-
bioRxiv - Neuroscience 2021Quote: ... siRNA complexes were introduced at multiple points between 700-250 μm below the surface of the brain using a Nanoject-2 (Drummond Scientific), culminating in a total injection volume of 10 μl per hemisphere ...
-
bioRxiv - Neuroscience 2020Quote: Transduction of neurons in rat hippocampal slice cultures was achieved by injecting concentrated viral particles into the CA1 pyramidal cell layer on DIV 1 or DIV 2 using a Nanoject II device (Drummond Scientific) (Krüger et al. ...
-
bioRxiv - Neuroscience 2020Quote: Transduction of neurons in hippocampal slice cultures was achieved by injecting concentrated viral particles into the CA1 pyramidal cell layer on DIV 1 or DIV 2 using a Nanoject II device (Drummond Scientific).
-
bioRxiv - Neuroscience 2021Quote: ... at 3 to 5 sites (1-2 μl; 1E13 GC/ml) through a beveled glass micropipette (15 to 25 μm tip diameter, Drummond Scientific) using a pressure injector (Drummond Nanoject II) ...
-
bioRxiv - Bioengineering 2020Quote: ... was made and a total of 2 µl of MENPs or MSNPs were injected with a microinjection apparatus Nanoject II (Drummond Scientific). In phase-I in vivo experiment MENPs injection was conducted only in right hemisphere to compare microglia and astrocytes population between injected and intact hemispheres ...
-
bioRxiv - Microbiology 2024Quote: ... mosquitoes were injected with 69 nl of a 2% green fluorescent FluoSpheres solution (in 1X PBS) using a Nanoject III (Drummond Scientific) and incubated at 27°C for 1 h to allow for bead uptake by hemocytes at 10 days post-infection ...
-
bioRxiv - Biochemistry 2022Quote: Sexually mature females (3 or 4 days old) were anaesthetized (Inject+matic sleeper TAS, Geneva, Switzerland) and injected (Nanoject II, Drummond Scientific/Olinto Martelli Srl, Florence, Italy) with 0.69μg (2x 69nL x 5μg/μL ...
-
bioRxiv - Microbiology 2019Quote: ... a different cohort of females was anaesthetised on ice and injected with 109 FFU/ml of DENV-2 in the thorax using a Nanoject II (Drummond Scientific, USA) hand-held microinjector ...
-
bioRxiv - Neuroscience 2020Quote: ... and -4.5 mm DV) using a 29 G stainless steel cannula connected to a 2 μl Hamilton syringe or a Nanoject system (Drummond Scientific, PA). The injectors were retracted slowly after 5 minutes ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... of purified dsRNA product was injected into the thorax of cold anesthetized 1–2-day old female mosquito using nano-injector (Drummond Scientific, CA, USA). The silencing of the respective gene was confirmed by quantitative RT-PCR after 3-4 -days of dsRNA injection.
-
A testis-specific Heme Peroxidase HPX12 regulates male fertility in the mosquito Anopheles stephensibioRxiv - Animal Behavior and Cognition 2020Quote: ... of purified dsRNA product was injected into the thorax of a cold anesthetized 1–2-day old male mosquito using a nano-injector (Drummond Scientific, CA, USA). The silencing of the respective gene was confirmed by quantitative RT-PCR after 3-4-days of dsRNA injection.
-
bioRxiv - Molecular Biology 2022Quote: ... 4 dpf larval zebrafish were anesthetized and injected directly into the cardiac valley with 2 pg of BefA or negative control vehicle again using the Nanoject II Auto-Nanoliter Injector (Drummond Scientific Company, Broomall, PA) as previously described (Wiles et al. ...
-
bioRxiv - Developmental Biology 2020Quote: ... the tissue was gently aspirated up and down using a micropipette (made from a pulled 50 μl calibrated micropipette (Drummond Scientific, Cat 2-000-050) attached to an aspirator tube) ...
-
bioRxiv - Developmental Biology 2020Quote: ... a single GFP-positive cell was collected from the host node (see ‘single cell manipulation’ below) and then transferred using a micropipette made from a pulled 50 μl calibrated micropipette (Drummond Scientific, Cat 2-000-050) attached to an aspirator tube ...