Labshake search
Citations for Drummond Scientific :
1 - 16 of 16 citations for 6 AMINO 4 METHYL INDOLE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... Approximately 200-300 nl of virus was injected over 4-6 minutes using a Nanoject II injector (Drummond Scientific). This injection coordinates primarily label the interposed nucleus of the deep cerebellar nuclei ...
-
bioRxiv - Neuroscience 2022Quote: ... A glass pipette containing the 6-OHDA solution or vehicle secured to a Nanoject (Drummond Scientific, Broomall, PA) was then lowered through the burr holes to a depth of 5.8 mm below the brain surface ...
-
bioRxiv - Genetics 2019Quote: ... Cold-anesthetized 5-6 day-old females were injected into their thorax using a nanoinjector (Nanoject II, Drummond Scientific) with 69 nL of bacteria or 138 nL of fluorescent beads ...
-
bioRxiv - Neuroscience 2022Quote: ... A total of ∼240 nL (41.4 nL x 6 at 23 nL/sec) was pressure-injected on each side using the Nanoject II (Drummond Scientific Company). The pipette was held in place for 5 minutes after injection to allow diffusion before being slowly retracted from the brain ...
-
bioRxiv - Microbiology 2021Quote: ... 18.6 nL of the mixture was injected into the second-instar nymph using a Nanoinject II auto-nanoliter injector (Drummond Scientific). The injected nymphs were reared on fresh rice seedlings and photographed with an Olympus stereomicroscope SEX16 (Olympus ...
-
bioRxiv - Neuroscience 2024Quote: ... 2.5 µl of viral particles (VP) with a titre of > 6×106 VP/mL where injected per hemisphere with a Nanoject V2 (Drummond Scientific Co ...
-
bioRxiv - Neuroscience 2023Quote: ... N=4) at 27.6 nL/min using a nanoliter injector (Nanoject II, Drummond Scientific) at 0.1 Hz ...
-
bioRxiv - Neuroscience 2021Quote: ... 0.6 mm rostral to bregma and 0.6 mm from the cortical surface) via pulled glass pipettes (5 μl, Drummond Scientific; 10-20 nl/min) using an automated injection system (Model Picospritzer iii ...
-
bioRxiv - Neuroscience 2022Quote: ... The oocytes were microinjected with 4□ng cRNA per oocyte with a Nanoject microinjector (Drummond Scientific Company). The oocytes were kept at 19°C for 3 days in Kulori medium prior to experiments ...
-
bioRxiv - Cell Biology 2020Quote: ... the embryos were collected and injected with 3.5 ng of either control morpholino oligo or with shank3a (AGAAAGTCTTGCGCTCTCACCTGGA) and/or shank3b (AGAAGCATCTCTCGTCACCTGAGGT) targeting morpholino oligos 55 into 1-4 cell stage embryos using Nanoject II microinjector (Drummond Scientific). To study the effects of shank3 mutations ...
-
bioRxiv - Cell Biology 2022Quote: ... 2.3 nl of solutions was injected into 1-4 cell stage zebrafish embryos of casper line using Nanoject II microinjector (Drummond Scientific). After injection ...
-
bioRxiv - Neuroscience 2022Quote: ... They were then subjected to an injection into the thorax with 32 nl heat-killed Staphylococcus aureus NCTC8325-4 (BAC) or PBS using a microinjector (Nanoject II; from Drummond Scientific).
-
bioRxiv - Microbiology 2023Quote: ... re-suspended in water was injected into the thorax of cold-anesthetized 3-4 day old female mosquitoes using a Nanoject III (Drummond Scientific).
-
bioRxiv - Microbiology 2021Quote: ... gambiae female mosquitoes (3-4 d old) were cold-anesthetized and inoculated intrathoracically with 69 nl of dsRNA using a nano-injector (Nanoject, Drummond Scientific, USA). Mosquitoes were maintained at 19 °C for 3 d before infecting with a blood meal ...
-
bioRxiv - Neuroscience 2022Quote: Separated stage IV/V oocytes were injected with 23-4 nL of WT or mutant RNA (Drummond Nanoinject, Drummond Scientific Co., Pennsylvania, USA). Injected oocytes were stored in frog Ringer’s solution (ND96 ...
-
bioRxiv - Biochemistry 2022Quote: Sexually mature females (3 or 4 days old) were anaesthetized (Inject+matic sleeper TAS, Geneva, Switzerland) and injected (Nanoject II, Drummond Scientific/Olinto Martelli Srl, Florence, Italy) with 0.69μg (2x 69nL x 5μg/μL ...