Labshake search
Citations for ChromoTek :
1 - 43 of 43 citations for Mouse AWAT2 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... The plasmid encoding the actin-chromobody (ChromoTek) was used to amplify the coding sequence of the chromobody under the control of the T7 promoter with actin-chromobody-for AATTAATACGACTCACTATAGGGAGAAAGGAGATATCCATGGCTCAGGTGCAGCTGGTGG and chromobody-RFP/GFP-rev TTATGATCTAGAGTCGCGGCCGC.
-
bioRxiv - Cell Biology 2022Quote: ... RFP mouse monoclonal antibody (ChromoTek GmbH ...
-
bioRxiv - Molecular Biology 2023Quote: ... mouse anti-RFP (Chromotek, 6G6) (diluted ...
-
bioRxiv - Cell Biology 2020Quote: ... fluorescent lamin nanobody (lamin chromobody) plasmid was purchased from ChromoTek and transferred into the NcoI-XbaI site of pGEMHE ...
-
bioRxiv - Cell Biology 2020Quote: ... PARP1-Chromobody (RFP-tag) plasmid was obtained from Chromotek (#xcr). All constructs were amplified with a Plasmid Midi Kit (Qiagen) ...
-
bioRxiv - Developmental Biology 2021Quote: The AC-TagGFP2 sequence from the Actin-Chromobody plasmid (TagGFP2) (Chromotek) was cloned into the pMTB vector for mRNA generation ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-RFP (1:1000, 6G6, Chromotek), rabbit anti-EGFR (1:1000 ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse anti-RFP (1:1000, Chromotek-6G6), and rabbit anti-GST (1:2000 ...
-
bioRxiv - Genetics 2022Quote: ... mouse anti-mNeonGreen (1:50, Chromotek, 32F6), rabbit anti-insulin (1:100 ...
-
bioRxiv - Plant Biology 2023Quote: ... monoclonal anti-RFP produced in mouse (Chromotek), polyclonal anti-tBFP produced in rabbit (Evrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... Halo-tag (mouse, 28a8 ChromoTek, 1:200), Alexa Fluor 647-direct labeled CETN1 (rabbit ...
-
bioRxiv - Cell Biology 2023Quote: ... mNeonGreen monoclonal mouse antibody (Chromotek, #32f6-100), p300 monoclonal mouse antibody (Santa Cruz Biotechnology ...
-
bioRxiv - Plant Biology 2024Quote: ... monoclonal anti- RFP produced in mouse (Chromotek), and monoclonal anti-HA produced in rat (Chromotek) ...
-
bioRxiv - Cell Biology 2020Quote: ... fluorescent nuclear actin nanobody (nuclear actin chromobody) plasmid was purchased from ChromoTek and transferred into the HindIII-EcoRI site of pGEMHE ...
-
bioRxiv - Cell Biology 2024Quote: ... Proteins were separated on 8% SDS-PAGE gels and detected by western blot using monoclonal mouse anti-HA (MMS-101R; Covance) or monoclonal mouse anti-RFP antibodies (6G6; ChromoTek) prior to secondary antibody treatment with polyclonal goat anti-mouse conjugated to horseradish peroxidase (115–035-146 ...
-
bioRxiv - Molecular Biology 2022Quote: ... produced in mouse and monoclonal anti-GFP (Chromotek) produced in rat were used as primary antibodies ...
-
bioRxiv - Cell Biology 2019Quote: ... The Cb-EmeraldFP plasmid consists of a sequence encoding actin chromobody (Cb) from Chromotek followed downstream by an in frame sequence encoding EmeraldFP ...
-
bioRxiv - Microbiology 2020Quote: Cells were transfected with plasmids and lysed for immunoprecipitation using GFP-Trap beads (Chromotek), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... An anti-mNG (mouse monoclonal IgG2c, ChromoTek 32f6, RRID:AB_2827566) or anti-TY (from BB2 hybridoma ...
-
bioRxiv - Cell Biology 2024Quote: For the subcloning of the actin chromobody sequence from the pAC-TagRFP plasmid (ChromoTek, Germany) into the pLew100_v5_Hyg plasmid (Wirtz et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... labeled using primary antibody (mouse anti-mNEONGreen, 1:1000, ChromoTek) and secondary antibody (goat anti-mouse conjugated with Alexa Fluor 555 ...
-
bioRxiv - Cell Biology 2022Quote: ... or mouse anti-mNeon Green (mNG) nanobody (ChromoTek, Planegg-Martinsried, Germany) to detect mNG fused to Tda1 ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were then sequentially incubated in mouse anti-mNeonGreen (IgG2c; Chromotek), followed by rat anti-mouse IgG(H+L)-AlexaFluor488 (ThermoFisher) ...
-
bioRxiv - Cell Biology 2022Quote: RPE-1 cells were transfected with 10µg Cell Cycle-Chromobody® plasmid (TagRFP) (From Chromotek, Planegg, Germany) using JET PRIME kit (Polyplus Transfection ...
-
bioRxiv - Cell Biology 2021Quote: Primary antibodies utilized for immunoblotting- mouse anti-mNeongreen (1:1000, Chromotek-32F6), rabbit anti-mNeongreen (1:1000 ...
-
bioRxiv - Cell Biology 2022Quote: ... Samples were probed with monoclonal mouse anti-mNeonGreen (mNeGr) IgGs (#32F6, Chromotek) and monoclonal mouse anti-GAPDH IgGs (#ab125247 ...
-
bioRxiv - Plant Biology 2023Quote: ... rabbit anti-GFP (1:1000) and mouse anti-RFP (1:2000) (ChromoTek) monoclonal primary antibodies were used in combination with anti-rabbit or anti-mouse IgG horseradish peroxidase conjugated secondary antibodies ...
-
bioRxiv - Biochemistry 2023Quote: For creation of cells stably expressing plasmids containing EGFP-SNM1A or a Chromobody® of RFP-PCNA (Chromotek), ∼5 x 105 cells were seeded in wells of a 6-well plate and immediately transfected with the desired plasmid (2.6 µg ...
-
bioRxiv - Microbiology 2021Quote: ... or ii) a monoclonal anti-mNeonGreen antibody (anti-mouse IgG2c, 1:100, ChromoTek). Stumpy BSF were identified at the molecular level with a rabbit polyclonal anti-PAD1 antibody (kindly provided by Keith Matthews ...
-
bioRxiv - Microbiology 2023Quote: ... or ii) a monoclonal anti-mNeonGreen antibody (anti-mouse IgG2c, 1:100, ChromoTek). CARP3 was detected using a polyclonal CARP3 antiserum (1:150 ...
-
bioRxiv - Molecular Biology 2020Quote: ... from HEK293 cells transfected with either the eGFP or the pEGFP-RNASEH2A plasmid was incubated with 30 ul of GFP-Trap MA coupled to magnetic particles (ChromoTek, Planegg-Martinsried Germany ...
-
bioRxiv - Cell Biology 2022Quote: ... Slides were incubated with the following antibodies: mouse α-mNeonGreen (1/500; 32F6, Chromotek) followed by α-mouse IgG Alexa Fluor 594 ...
-
bioRxiv - Cell Biology 2019Quote: U2OS cells endogenously expressing C-terminal mEGFP-tagged MCM2 were transfected with plasmid (pCellCycleChromobody-RFP) containing RFP-PCNA chromobody (Chromotek, ccr) encoding single chain antibody recognizing endogenous PCNA protein ...
-
bioRxiv - Developmental Biology 2021Quote: ... and then incubated overnight at 4°C with primary antibody (mouse anti-mNeonGreen [32F6], Chromotek, 1:250) diluted in PBT + 1x WBR ...
-
bioRxiv - Cell Biology 2020Quote: ... the PepNb sequence was ligated into BglII- and BstEII-digested backbone plasmids previously described as lamin-chromobody (eGFP) 7 and PCNA-chromobody (TagRFP) 33 (kindly provided by ChromoTek GmbH, Planegg-Martinsried, Germany). To generate homologous DNA for AAVS1 PepCB integration ...
-
bioRxiv - Microbiology 2021Quote: ... incubated with a 1:1,000 dilution of mouse anti-GFP [B-2] (SantaCruz Biotechnology) or a rat anti-RFP [5F8] (Chromotek) followed by a 1:5,000 dilution of the horseradish peroxidase-conjugated secondary antibody against mouse IgG (7076 ...
-
bioRxiv - Plant Biology 2020Quote: ... the membrane was probed with the indicated primary antibody (rabbit anti-GFP [1:1500, Abcam, #ab290], mouse anti-RFP [1:1000, Chromotek, #6G6] ...
-
bioRxiv - Plant Biology 2020Quote: ... The roots were incubated overnight at 4°C with the secondary anti-mouse (1:500; Jackson immunoreactive, conjugated to Rhodamine Red) and eba488-10 Spot Label ATTO488 (1:1000, Chromotek) diluted in PBS supplemented with 2% (w/v ...
-
bioRxiv - Immunology 2022Quote: ... and c-Myc–tagged recombinant mouse NEU3 was purified using a Myc-Trap agarose kit (ytak-20; Chromotek, Hauppauge, NY) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... Arabidopsis stable lines expressing native VAP27-1-RFP or Mito-mCherry were stained with anti-TraB1a mouse primary antibody at a dilution of 1:500 and anti-RFP rat primary antibody (Chromotek), followed by secondary antibody incubation with FITC conjugated against mouse ...
-
bioRxiv - Cell Biology 2023Quote: ... portions of the blot were reacted against anti- mNeonGreen (mouse monoclonal antibody 32F6 from Chromotek, Inc., at 1:200 dilution), anti- HA (rabbit monoclonal antibody ...
-
bioRxiv - Microbiology 2021Quote: ... Slides were subsequently blocked overnight in PBS containing 3% BSA before labelling with anti-mNeonGreen mouse monoclonal antibody (32F6; 1:300; Chromotek, Germany) followed by Alexa Fluor 488 goat anti-mouse antibody (1:1000 ...
-
bioRxiv - Neuroscience 2021Quote: ... Membranes were then probed overnight at 4°C with TBST buffer containing 1% non-fat dry milk and primary antibodies: mouse monoclonal anti-RFP (Chromotek, clone 6G6, 1:3,000), rabbit polyclonal anti-GFP (SYSY ...