Labshake search
Citations for ChromoTek :
1 - 15 of 15 citations for Human PIGV shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... The plasmid encoding the actin-chromobody (ChromoTek) was used to amplify the coding sequence of the chromobody under the control of the T7 promoter with actin-chromobody-for AATTAATACGACTCACTATAGGGAGAAAGGAGATATCCATGGCTCAGGTGCAGCTGGTGG and chromobody-RFP/GFP-rev TTATGATCTAGAGTCGCGGCCGC.
-
bioRxiv - Cell Biology 2020Quote: ... fluorescent lamin nanobody (lamin chromobody) plasmid was purchased from ChromoTek and transferred into the NcoI-XbaI site of pGEMHE ...
-
bioRxiv - Cell Biology 2020Quote: ... PARP1-Chromobody (RFP-tag) plasmid was obtained from Chromotek (#xcr). All constructs were amplified with a Plasmid Midi Kit (Qiagen) ...
-
bioRxiv - Developmental Biology 2021Quote: The AC-TagGFP2 sequence from the Actin-Chromobody plasmid (TagGFP2) (Chromotek) was cloned into the pMTB vector for mRNA generation ...
-
bioRxiv - Cell Biology 2020Quote: ... fluorescent nuclear actin nanobody (nuclear actin chromobody) plasmid was purchased from ChromoTek and transferred into the HindIII-EcoRI site of pGEMHE ...
-
bioRxiv - Cell Biology 2019Quote: ... The Cb-EmeraldFP plasmid consists of a sequence encoding actin chromobody (Cb) from Chromotek followed downstream by an in frame sequence encoding EmeraldFP ...
-
bioRxiv - Microbiology 2020Quote: Cells were transfected with plasmids and lysed for immunoprecipitation using GFP-Trap beads (Chromotek), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: For the subcloning of the actin chromobody sequence from the pAC-TagRFP plasmid (ChromoTek, Germany) into the pLew100_v5_Hyg plasmid (Wirtz et al. ...
-
bioRxiv - Cell Biology 2022Quote: RPE-1 cells were transfected with 10µg Cell Cycle-Chromobody® plasmid (TagRFP) (From Chromotek, Planegg, Germany) using JET PRIME kit (Polyplus Transfection ...
-
bioRxiv - Immunology 2023Quote: The coding sequence of the Dnmt1-chromobody targeting the human Dnmt1 protein [37] (Uniprot : P26358 · DNMT1_HUMAN) and lamin-chromobody (ChromoTek) targeting the lamin D0 from Drosophila monogaster (Uniprot ...
-
bioRxiv - Biochemistry 2023Quote: For creation of cells stably expressing plasmids containing EGFP-SNM1A or a Chromobody® of RFP-PCNA (Chromotek), ∼5 x 105 cells were seeded in wells of a 6-well plate and immediately transfected with the desired plasmid (2.6 µg ...
-
bioRxiv - Molecular Biology 2020Quote: ... from HEK293 cells transfected with either the eGFP or the pEGFP-RNASEH2A plasmid was incubated with 30 ul of GFP-Trap MA coupled to magnetic particles (ChromoTek, Planegg-Martinsried Germany ...
-
bioRxiv - Neuroscience 2021Quote: ... GFP-Trap agarose beads were used to pull down the GFP-human TDP-43 (residues 216-414) or GFP protein (Chromotek, gta-10). Blots were probed with antibodies for mouse anti-Myc antibody (1:1000 ...
-
bioRxiv - Cell Biology 2019Quote: U2OS cells endogenously expressing C-terminal mEGFP-tagged MCM2 were transfected with plasmid (pCellCycleChromobody-RFP) containing RFP-PCNA chromobody (Chromotek, ccr) encoding single chain antibody recognizing endogenous PCNA protein ...
-
bioRxiv - Cell Biology 2020Quote: ... the PepNb sequence was ligated into BglII- and BstEII-digested backbone plasmids previously described as lamin-chromobody (eGFP) 7 and PCNA-chromobody (TagRFP) 33 (kindly provided by ChromoTek GmbH, Planegg-Martinsried, Germany). To generate homologous DNA for AAVS1 PepCB integration ...