Labshake search
Citations for Invivogen :
1 - 27 of 27 citations for Nipah virus Nucleoprotein N His tag since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... with cMyc tag and 6xHis-tag at the nanobody’s C-terminal were cloned into a pFUSE-derived vector (InvivoGen). The vector was used to transform Expi293F mammalian cells (ThermoFisher) ...
-
bioRxiv - Microbiology 2020Quote: ... virus stocks were confirmed to be free of mycoplasma (PlasmoTest, InvivoGen) and other adventitious agents by deep sequencing on a MiSeq platform (Illumina ...
-
bioRxiv - Genetics 2019Quote: ... Virus transduced cells were maintained for 2 weeks under blasticidin (10 μg/ml, Invivogen) selection ...
-
bioRxiv - Cell Biology 2020Quote: ... cells infected with shRNA encoding virus were selected in puromycin (2 μg/mL, InvivoGen, ant-pr) and used 4 days post infection.
-
bioRxiv - Physiology 2023Quote: The selection for virus-infected HDFs has performed with 4μg/ml blasticidin (Invivogen, San Diego, California) selection media ...
-
bioRxiv - Microbiology 2023Quote: ... Envelope defective virus was pseudotyped with HU-1 SARS-CoV-2 Spike protein (pLV-Spike, Invivogen) and used for single round infection assays ...
-
bioRxiv - Microbiology 2021Quote: ... Virus samples were then diluted 1:1 with the adjuvant Addavax (Invivogen cat. no. vac-adx-10) to a final concentration of 100 μg/mL ...
-
bioRxiv - Immunology 2022Quote: ... Mice were infected intranasally with 3×104 PFU of x31-PmpG-1 virus and boosted intranasally with 1μg PmpG-1303-311 peptide + 2μg CpG (ODN 1826, Invivogen) on days 14 and 28 (75) ...
-
bioRxiv - Cell Biology 2022Quote: ... for TIRF-M imaging or with N-(1-Pyrenyl)maleimide (Invivogen) for pyrene-actin polymerization assays ...
-
bioRxiv - Microbiology 2020Quote: ... recombinant RBD protein containing a C-terminal 6xHis tag was formulated with the Alhydrogel adjuvant (Invivogen) and each vaccine dose contained 5 μg of RBD and 500 μg of aluminum hydroxide ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were transduced with murine leukemia virus-based transduction vectors and subsequently transduced cells were selected with puromycin (Invivogen). Authentication of cell lines was performed by STR-typing ...
-
bioRxiv - Immunology 2021Quote: ... CD14+ cells were cultured o/n with 100 ng/mL LPS (Invivogen) and treated with 300 nM JQ1(- ...
-
bioRxiv - Genetics 2019Quote: ... The untransduced cells and serially diluted virus-treated cells were cultured in the presence of 2 μg/ml puromycin or 20 μg/ml blasticidin S (InvivoGen). When almost all of the untransduced cells had died ...
-
bioRxiv - Molecular Biology 2019Quote: Wild-type and mutants MmEsco2-myc/his and H2B-mCherry were cloned into the pVITRO2-hygro-mcs vector (InvivoGen) in two steps ...
-
bioRxiv - Immunology 2022Quote: ... cDNA encoding His-tagged Spike and RBD variants of SARS-CoV-2 were sub-cloned into pFUSE2ss-CLIg-hk (InvivoGen). The vectors were transfected as described for above the ACE2-albumin fusion protein and secreted His-tagged proteins were purified on HisTrap™ HP 1 mL columns (Cytiva) ...
-
bioRxiv - Microbiology 2022Quote: ... A549 lung carcinoma cells expressing human ACE2 and human TMPRSS2 (A549.ACE2+.TMPRSS2+; cat n° a549-hace2tpsa, Invivogen) were grown in DMEM/10% FBS supplemented with 100 µg/ml Normocin ...
-
bioRxiv - Physiology 2023Quote: Mouse FGL1 cDNA sequences (full length, N-terminal domain, globular domain) were cloned into pFUSEN-hG2Fc plasmid (InvivoGen) with the following modifications ...
-
bioRxiv - Immunology 2022Quote: ... N = 3) were immunized with a mixture of 50 μg each of H1ssF and H10ssF formulated with AddaVax (Invivogen) in 1 ml via intramuscular route at weeks 0 ...
-
bioRxiv - Molecular Biology 2021Quote: ... while zeocin was added at 800μg/ml for counter selection of stable transfected cells (InvivoGen, cat n°ant-zn1). Stable transformants were maintained in media supplemented with blasticidin and 50 μg/ml Hygromycin B Gold (InvivoGen ...
-
bioRxiv - Molecular Biology 2020Quote: ... followed by 2,5 μM BV6 (Selleckchem) pre-treatment (SK-N-AS cells only) and treatment with 10 μg/ml poly(I:C) (Invivogen). Human TNF-α (600 lU/ml ...
-
bioRxiv - Immunology 2023Quote: ... we immunized two groups of BALB/c mice (n=10) with 5 µg protein antigens adjuvanted with 10 µg Monophosphoryl lipid A (MPLA, Invivogen) and 10 µg Quil-A (Invivogen ...
-
bioRxiv - Immunology 2020Quote: ... where n=2) were immunized with the indicated immunogen in 100 μL of 50% v/v of AddaVax™ adjuvant (Invivogen) and boosted with adjuvant on Day 14 ...
-
bioRxiv - Immunology 2023Quote: ... we immunized three groups of C57BL/6 mice (n=9) with 5 µg protein antigens adjuvanted with 500 µg alum (Alhydrogel®, Invivogen) and 20 µg CpG (ODN 1826 ...
-
bioRxiv - Immunology 2024Quote: ... or GpC:ODN control (n=4) (CpG-B no.1826, TCCAT GACG TTCCT GACGTT; control non-CpG-B no.2138, TCCATGAGCTTCCTGAGCTT, Invivogen, USA). At 24 hours ...
-
bioRxiv - Molecular Biology 2021Quote: ... Stable transformants were maintained in media supplemented with blasticidin and 50 μg/ml Hygromycin B Gold (InvivoGen, cat n°ant-hg-1).
-
bioRxiv - Immunology 2024Quote: ... were immunised IM with 10 µg N-half RIPR or 13 µg full-length RIPR protein formulated in AddaVax™ (Invivogen, France) on days 0 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Parent Flp-In™ T-REx™-293 cells were additionally supplemented with 15 μg/ml blasticidin (InvivoGen, cat n°ant-bl-1) and 100 μg/ml zeocin for cultivation ...