Labshake search
Citations for Invivogen :
101 - 150 of 497 citations for tert Butyl 10 oxo 4 9 diazaspiro 4.5 decane 4 carboxylate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... dexamethasone (Invivogen, 10 μM, 24 h).
-
bioRxiv - Cell Biology 2020Quote: ... or 10 μg/ml blasticidin (InvivoGen)) was started 24 h after the last infection and continued for one week.
-
bioRxiv - Synthetic Biology 2020Quote: ... and 10 μg/mL zeocin (InvivoGen). Single-cell clones were isolated by the limiting dilution method.
-
bioRxiv - Synthetic Biology 2020Quote: ... 10 μg/mL blasticidin S (InvivoGen), 1.0 μg/mL puromycin (InvivoGen) ...
-
bioRxiv - Microbiology 2020Quote: ... 10 μg/ml of blasticidin (Invivogen) and 100 μg/ml of Zeocin™ (Invivogen).Caco-2 and Calu-3 cells were stimulated for 24 h with media containing TLR4 agonist Lipopolysaccharide (LPS ...
-
bioRxiv - Immunology 2020Quote: ... FSL-1 (10 ng/mL) (Invivogen), or CDTa and CDTb (5 ng/mL each ...
-
bioRxiv - Genetics 2022Quote: ... MycoStrip™ (InvivoGen, rep-mys-10) did not detect mycoplasma contamination in any of the cell cultures used in this study.
-
bioRxiv - Microbiology 2022Quote: ... 10 μg/ml of blasticidin (InvivoGen), and penicillin-streptomycin (Gibco) ...
-
bioRxiv - Cell Biology 2023Quote: ... cGAMP (10 μg ml-1, Invivogen), poly-I:C (5 μg ml-1 ...
-
bioRxiv - Bioengineering 2023Quote: AddaVax™ (Invivogen, vac-adx-10), a squalene-based oil-in-water nano-emulsion ...
-
bioRxiv - Cell Biology 2023Quote: ... or 10 µg/ml blasticidin (InvivoGen). Single cells were sorted by FACS and propagated to create monoclonal lines ...
-
bioRxiv - Bioengineering 2023Quote: ... 10 µg/mL of blasticidin (Invivogen) and 200 µg/mL of hygromycin (Invivogen ...
-
bioRxiv - Immunology 2023Quote: ... and 10 µg Quil-A (Invivogen) via subcutaneous injection on day 0 and 21 ...
-
bioRxiv - Immunology 2023Quote: ... 10 μM nigericin (tlrl-nig; InvivoGen), 1 μM MCC950 (17510 ...
-
bioRxiv - Immunology 2024Quote: ... with 10 μg/ml Blasticidin (Invivogen). HEK-293T cells45 were also maintained in complete DMEM ...
-
bioRxiv - Immunology 2024Quote: ... or 10 µg/ml LPS (InvivoGen).
-
bioRxiv - Immunology 2024Quote: ... Addavax (Invivogen, cat. Vac-adx-10) and Emulsigen D (MVP Adjuvants) ...
-
bioRxiv - Biochemistry 2024Quote: ... and 10 μg/mL blasticidin (InvivoGen). HEK 293T cells were grown at 37°C under 5% CO2 in DMEM supplemented with 10% FBS ...
-
bioRxiv - Systems Biology 2021Quote: ... 10% U.S Origin FBS (GenClone #25-514) with 10 μg/mL hygromycin B ([Invivogen ant-hg-1). Cells were cultured in T-25 ...
-
bioRxiv - Cell Biology 2022Quote: ... Transfected cells were selected 24 h after transfection with either 10 μg·mL-1 Blasticidin S or 10 μg·mL-1 G418 (both InvivoGen). Gene disruptions were confirmed either by immunoblotting (forB- and forG- ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 10 µg/mL of blasticidin (InvivoGen).
-
bioRxiv - Cell Biology 2021Quote: ... 10 μg/ml poly(I:C) (HMW, Invivogen) or 1 μg/ml LPS (from Escherichia coli strain 0127:B8 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 10 μg ml-1 blasticidin (InvivoGen) and independent clones obtained by limiting dilution ...
-
bioRxiv - Cancer Biology 2020Quote: ... 10 μg mL-1 of Blasticidin (Invivogen) and 1000 μg mL-1 G418 (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2020Quote: ... selecting with 10 μg/ml blasticidin (InvivoGen) and 2 μg/ml puromycin (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2020Quote: ... 10-15 µg mL-1 G418 (InvivoGen), 50 µg mL-1 hygromycin (InvivoGen ...
-
bioRxiv - Microbiology 2020Quote: ... and puromycin at 10 µg/ml (InvivoGen).
-
bioRxiv - Immunology 2020Quote: ... and 10 µg monophosphoryl Lipid A (InVivogen) diluted in 1X Dulbecco’s phosphate-buffered saline (DPBS ...
-
bioRxiv - Immunology 2021Quote: ... supplemented with 10 μg/mL blasticidin (Invivogen) to maintain TMPRSS2 expression ...
-
bioRxiv - Immunology 2020Quote: ... CpG2006 (TLR9; tlrl-2006; Invivogen, 10 μM), Flagellin (TLR5 ...
-
bioRxiv - Cancer Biology 2022Quote: ... LPS (10 μg/mL, InvivoGen tlrl-eblps), ssDNA (1 μg/mL ...
-
bioRxiv - Cancer Biology 2022Quote: ... or blasticidin (InvivoGen, 5 ∼ 10 µg/ml), as appropriate.
-
bioRxiv - Immunology 2022Quote: ... and 10 µg/mL of blasticidin (InvivoGen). MDBK-t2 cells were seeded into 24-well plates at 1 × 105 / well and incubated at 37°C in a 5% CO2 incubator overnight ...
-
bioRxiv - Immunology 2022Quote: ... OVA + CpG (10 μg, Invivogen, Cat# ODN1826) and OVA + Alum (200 μg Sigma ...
-
bioRxiv - Cell Biology 2024Quote: ... 5-10 μg/ml blasticidin S (Invivogen) or FACS ...
-
bioRxiv - Bioengineering 2024Quote: ... and 10 μg saponin (InvivoGen, vac-quil) in PBS ...
-
The T-cell niche tunes immune function through modulation of the cytoskeleton and TCR-antigen forcesbioRxiv - Bioengineering 2024Quote: ... 10 ug/mL blinatumomab (InVivoGen, # bimab-hcd19cd3) in PBS was added to CD19 probes for 1h ...
-
bioRxiv - Immunology 2023Quote: ... 10 µg/mL Ac-YVAD-cmk (Invivogen), 5 µg/mL RU.521 (Invivogen) ...
-
bioRxiv - Cell Biology 2022Quote: ... and/or 10 μg/ml blasticidin (InvivoGen). Expression of double-stranded RNA was induced by adding 1 μg/ml tetracycline (Sigma-Aldrich ...
-
bioRxiv - Immunology 2024Quote: ... VX-765 (Invivogen; final concentration 10 µM), was used as a positive control for inflammasome inhibition.
-
bioRxiv - Biochemistry 2024Quote: ... AddaVax (InvivoGen Cat t#vac-adx-10) was purchased as a 2x ready-to-use suspension ...
-
bioRxiv - Cell Biology 2024Quote: ... PolyI:C (10 mg/mL, InvivoGen; tlrl-picw), FAS ligand (10 ng/mL ...
-
bioRxiv - Cancer Biology 2024Quote: ... 10 µg/ml blasticidin (InvivoGen, ant-bl), or 800 µg/ml neomycin (Thermo Scientific ...
-
bioRxiv - Systems Biology 2023Quote: ... the cells were trypsinized and transferred to a 10 cm dish containing DMEM supplemented with 10% FBS and 200 µg/ml hygromycin B (Invivogen) for selection ...
-
bioRxiv - Immunology 2023Quote: ... we immunized two groups of BALB/c mice (n=10) with 5 µg protein antigens adjuvanted with 10 µg Monophosphoryl lipid A (MPLA, Invivogen) and 10 µg Quil-A (Invivogen ...
-
bioRxiv - Neuroscience 2021Quote: ... Puromycin (Invivogen 10 mg/ml, ant-pr-1) selection with 0.2 µg/ml in E8 medium started two days after transfection ...
-
bioRxiv - Immunology 2021Quote: ... or stimulated with 10 ug/ml Pam3CSK4 (Invivogen), 10 ng/mL LPS from Salmonella typhosa (Sigma) ...
-
bioRxiv - Immunology 2021Quote: ... 10 ug/mL flagellin from Salmonella typhimurium (Invivogen), 10 ug/mL lipoteichoic acid (LTA ...
-
bioRxiv - Immunology 2021Quote: ... 10 μg of OVA (Cat: VAC-POVA, Invivogen) and 8 μg of CpG (Cat ...
-
bioRxiv - Cell Biology 2021Quote: ... After selection with 10 µg/mL blasticidin (Invivogen), a monoclonal cell line showing high CasRx expression after dox treatment was further transduced with SEDT2 gRNA#1 (AGATCCACAACAAAGACAGCCCA) ...