Labshake search
Citations for BestGene :
1 - 26 of 26 citations for Spleen Focus Forming Virus Proviral Integration Oncogene SPI1 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... using ΦC31 integration (BestGene). For the generation of UAS-DIP-δ RNAi ...
-
bioRxiv - Neuroscience 2020Quote: ... using ΦC31 integration (BestGene).
-
bioRxiv - Neuroscience 2020Quote: ... using ΦC31 integration (BestGene).
-
bioRxiv - Neuroscience 2021Quote: ... melanogaster germline transformation with the prepared plasmid was carried out by BestGene using the PhiC31 integration + Cre-loxP removal plan (Bestgene, www.thebestgene.com). The vector was inserted into chromosome III to produce the genotype +;+;UAS-GINKO1/TM3 ...
-
bioRxiv - Neuroscience 2021Quote: ... and were inserted into the genome via phiC31-mediated integration (BestGene). All fly strains were backcrossed to the isogenic w1118 wildtype (+/+ ...
-
bioRxiv - Cell Biology 2020Quote: ... and cloned into pUAST.attB for integration at the attP40 locus (BestGene Inc.). All experiments in adult flies were conducted using males ...
-
bioRxiv - Developmental Biology 2019Quote: ... yw embryos for integration into the 2nd chromosome attp16 locus by BestGene Inc ...
-
bioRxiv - Neuroscience 2021Quote: ... melanogaster using the phiC31 site-specific integration system (landing site attP40) by BestGene Inc ...
-
bioRxiv - Neuroscience 2022Quote: ... P[CaryP]attP2 (BI #8622) by injection and phiC31 integration (BestGene Inc, USA). The tubulin-gal4 and MHC-Gal4 line were generously provided by Dr ...
-
bioRxiv - Neuroscience 2020Quote: ... The pCFD4-Dpr12 plasmid was injected into 86FB landing sites using ΦC31 integration (BestGene). Injected flies were crossed with nanos-Cas9 flies (Bloomington stock #54591) ...
-
bioRxiv - Cell Biology 2021Quote: Transgenic lines were generated using pUAST-AttB and phiC31 integrase-mediated DNA integration (BestGene) that allows the insertion of the transgenes in a specific site of the acceptor fly genome ...
-
bioRxiv - Cell Biology 2022Quote: ... The plasmid was then injected into attP112 (III) lines for phiC31-mediated integration by BestGene.
-
bioRxiv - Neuroscience 2023Quote: ... and it was utilized for attp154 landing site-specific integration on the 2nd chromosome (Bestgene).
-
bioRxiv - Cell Biology 2023Quote: ... The following transgenic fly stocks were generated in this study using PhiC31-mediated integration (BestGene Inc.): UASp-sfGFP-msps 3’UTR and UASp-sfGFP-K10CT 3’UTR (inserted at 89E11 ...
-
bioRxiv - Genetics 2022Quote: ... each was embryonically injected and integrated via phiC31 integration into PBac{y+-attP-3B}VK00031 (62E) (BestGene). Positive integrants were confirmed by expression of mini-white in a y2 wΔ background ...
-
bioRxiv - Neuroscience 2022Quote: ... Transgenic flies were generated by PhiC31-mediated integration of the construct into the attP40 landing site (BestGene).
-
bioRxiv - Neuroscience 2022Quote: ... and transgenic flies were generated by site-specific integration into the VK00027 landing site (BestGene, Inc., Chino Hills, CA). To verify the selectivity of the driver ...
-
bioRxiv - Developmental Biology 2022Quote: ... all MS2 reporters were inserted at the vk33 docking site (Bloomington # 9750) via ϕC31 mediated integration system (Venken et al., 2006) by BestGene. The site of insertion was chosen because the transcription dynamics of the original hb-P2 reporter (Lucas et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... flies carrying an ectopic copy of the CAP-H2 gene and regulatory regions were produced by random P-element integration (Bestgene). Cap-H2 genomic region was amplified using 5’ GCATGAGCGGCCGCGGCGAA TCACTCACGATAGTG 3’ and reverse 5’ GCATGAGGTACCCACAAGA ACATGTGGGAGCTC 3 primers ...
-
bioRxiv - Developmental Biology 2021Quote: ... constructs were integrated into the third chromosome using the ϕC31-based integration system55 at the VK33 site (65B2) by BestGene. NLS-mCherry-LEXY and NLS-EGFP-LEXY constructs were integrated into the second chromosome at the VK02 site (47C6) ...
-
bioRxiv - Neuroscience 2023Quote: ... All three bdwf transgenes were generated by ΦC31-mediated integration with targeting to 2R (51C1) (BestGene, Chino Hills, CA, USA). All constructs were sequenced verified for accuracy.
-
bioRxiv - Cell Biology 2021Quote: ... the pGE-attB-GMR integration plasmid containing the new allele was injected into αTub84BattP-KO embryos expressing the integrase PhiC31 (BestGene Inc.). The following mutations were introduced into the integration plasmid by Phusion high fidelity polymerase ...
-
bioRxiv - Developmental Biology 2021Quote: ... The various transgenic reporters were integrated into the VK37 site on chromosome 2 using φC31-mediated integration (Bischof and Basler, 2008) (BestGene, Chino Hills, CA). L3 brains from reporter fly lines were dissected ...
-
bioRxiv - Developmental Biology 2021Quote: ... These transgenes were integrated at ZH-86Fb site on chromosome 3 using φC31-mediated integration (Bischof and Basler, 2008) (BestGene, Chino Hills, CA). Worniu-Gal4 ...
-
bioRxiv - Developmental Biology 2021Quote: ... The various transgenic reporters were integrated into the VK31 site on chromosome 3 using φC31-mediated integration (Bischof and Basler, 2008) (BestGene, Chino Hills, CA).
-
bioRxiv - Developmental Biology 2022Quote: ... These transgenes were integrated at ZH-86Fb site on chromosome 3 using φC31-mediated integration (Bischof and Basler 2008) (BestGene, Chino Hills, CA). The Wor-Gal4 ...