Labshake search
Citations for BestGene :
1 - 5 of 5 citations for Siglec 5 Human HEK293 His Flag Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2021Quote: ... UAS-dSLC5A5-FLAG transgenic flies were generated by BestGene Inc ...
-
bioRxiv - Developmental Biology 2023Quote: ... Transgenic flies were injected with UASP-baz-Flag ppWF plasmid by BestGene.
-
bioRxiv - Neuroscience 2023Quote: ... and UAS-flag-NF242 transgenic lines were generated by random germline insertion into w1118 flies (w-) (BestGene). GMR-Gal4 ...
-
bioRxiv - Neuroscience 2021Quote: ... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
bioRxiv - Developmental Biology 2024Quote: ... We also generated additional fly lines in which the entire Ds-ICD was substituted with the ICD from human DCHS1 using microinjection services from BestGene. ds alleles were recombined with FRT40A for mitotic recombination ...