Labshake search
Citations for BestGene :
1 - 17 of 17 citations for Rat Starch Binding Domain Containing Protein 1 STBD1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2024Quote: ... Constructs of Spc105R with deletions or mutations of these domains were injected into Drosophila melanogaster embryos (Model System Genomics or BestGene). The linkage of the transgenes was determined and insertions on the 3rd chromosome were recombined onto the same chromosome as the shRNA GL00392.
-
bioRxiv - Developmental Biology 2021Quote: ... Plasmids were injected into an attP2 containing stock (BestGene) for site-specific integration.
-
bioRxiv - Genetics 2022Quote: ... All injection and selection of flies containing integrated transgene were performed by BestGene Inc ...
-
bioRxiv - Neuroscience 2021Quote: ... These constructs were injected into embryos containing the VK27 attP acceptor site by BestGene, Inc (BDSC #9744) ...
-
bioRxiv - Cell Biology 2023Quote: ... wherein the plasmid containing αTub84B-mCh-D4H was injected into w1118 embryos by BestGene Inc ...
-
bioRxiv - Cell Biology 2019Quote: ... Circular Rpl13a repair template was then microinjected into the embryos containing both active Cas9 and sgRNA (BestGene, Inc). Surviving flies were intercrossed with one another and the resulting offspring were screened for red or blue fluorescence signals at wandering 3rd instar larval stage ...
-
bioRxiv - Cell Biology 2020Quote: ... Transgenes were sequenced and then injected into embryos containing an attP8 site on the X chromosome (BDSC stock #32233, BestGene).
-
bioRxiv - Developmental Biology 2021Quote: Two hundred vasa-Cas9 embryos were injected with a mixture containing 100 ng/μL pU6-chiRNA:sgRNA and 100 ng/μL ssODN (BestGene Inc.). Transformant G0 flies (48 females and 44 males ...
-
bioRxiv - Cell Biology 2023Quote: ... This plasmid was co-injected along with two gRNA-expressing plasmids (pU6-Bbs1-ChiRNA containing gRNA1: GATCCACTGGCTCTCGCTTA and gRNA2: GCATCAGGTTCACCTCAGAGG in embryos from the nos-Cas9 strain (2nd chromosome, BDSC78781) by Bestgene Inc ...
-
bioRxiv - Microbiology 2024Quote: ... The resulting pUASt-based plasmids containing the VSV G or GP64 fragments were injected into W1118 flies (BestGene Inc, California), and transgenic fly lines were verified for expression of the viral envelope proteins (WT and ΔY versions of VSV G and GP64 ...
-
bioRxiv - Cell Biology 2021Quote: ... the pGE-attB-GMR integration plasmid containing the new allele was injected into αTub84BattP-KO embryos expressing the integrase PhiC31 (BestGene Inc.). The following mutations were introduced into the integration plasmid by Phusion high fidelity polymerase ...
-
bioRxiv - Neuroscience 2023Quote: ... attB-containing plasmids with ppk1 knock-in alleles were injected into ppk1attP-KO embryos expressing ΦC31 integrase (BestGene Inc., Chino Hills, CA). The GMR-mini-w+ and 3xP3-DsRed markers were subsequently removed by crossing to flies expressing Cre recombinase.
-
bioRxiv - Neuroscience 2019Quote: ... The expression vectors containing the codon optimized TDP-43 gene were then microinjected into the flies to obtain transgenic flies (BestGene, Chino Hills, CA, USA). The expression of non-CO-TDP-43 is driven in the fly eye by the glass multimer reporter ...
-
bioRxiv - Developmental Biology 2022Quote: ... The obtained tey-pCFD6-4 plasmid containing the four tey guide RNAs under the control of UAS sequences were injected for insertion into AttB40 (BestGene Inc, Chino Hills, CA). Homozygous transgenic lines were crossed with nos-Gal4VP14 UAS-cas9 and balanced flies from established lines were tested by PCR and sequencing for CRISPR/Cas9-induced deletions in tey.
-
bioRxiv - Physiology 2023Quote: ... and correctly assembled clones were midi-prepped using Qiagen kits and integrated into the genome at the attP2 third-chromosome site by BestGene, Inc (Chino Hills ...
-
bioRxiv - Neuroscience 2022Quote: ... and donor vector (400 ng μl-1) into {Act5C-Cas9.P.RFP-}ZH-2A w[118] Lig[169]flies was performed by BestGene Inc ...
-
bioRxiv - Cell Biology 2023Quote: ... The DNA plasmid of pScarlessHD-5’ msps homology arm-C-3xVHH05-6XMS2-DsRed-3’ msps homology arm was co-injected with pCFD5-gRNA#1 and pCFD5-gRNA#2 by BestGene. Flies with fluorescent red eyes were selected and crossed with Tub-PBac flies to remove the DsRed region by PBac transposase ...