Labshake search

Citations for BestGene :

1 - 2 of 2 citations for IL 5 Human CHO since 2019

Citations are collected from bioRxiv only, the total number of publications could be much larger.

  • Homeostatic active zone remodeling consolidates memories in the Drosophila mushroom body
    Oriane Turrel, et al., bioRxiv - Neuroscience 2021
    Quote: ... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
  • Contributions of the Dachsous intracellular domain to Dachsous-Fat signaling
    Bipin Kumar Tripathi, Kenneth D. Irvine, bioRxiv - Developmental Biology 2024
    Quote: ... We also generated additional fly lines in which the entire Ds-ICD was substituted with the ICD from human DCHS1 using microinjection services from BestGene. ds alleles were recombined with FRT40A for mitotic recombination ...
Feedback