Labshake search
Citations for BestGene :
1 - 5 of 5 citations for Human Immunodeficiency Virus Reverse Transcriptase Protein HIV 1 Clade B IIIB since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... Wild-type and deletion mutant plasmid constructs for Drosophila Calpain A and Calpain B were synthesized and sub-cloned in the pUASTattb vector to generate transgenic Drosophila lines from BestGene.
-
bioRxiv - Neuroscience 2021Quote: ... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
bioRxiv - Developmental Biology 2024Quote: ... We also generated additional fly lines in which the entire Ds-ICD was substituted with the ICD from human DCHS1 using microinjection services from BestGene. ds alleles were recombined with FRT40A for mitotic recombination ...
-
bioRxiv - Neuroscience 2022Quote: ... and donor vector (400 ng μl-1) into {Act5C-Cas9.P.RFP-}ZH-2A w[118] Lig[169]flies was performed by BestGene Inc ...
-
bioRxiv - Cell Biology 2023Quote: ... The DNA plasmid of pScarlessHD-5’ msps homology arm-C-3xVHH05-6XMS2-DsRed-3’ msps homology arm was co-injected with pCFD5-gRNA#1 and pCFD5-gRNA#2 by BestGene. Flies with fluorescent red eyes were selected and crossed with Tub-PBac flies to remove the DsRed region by PBac transposase ...