Labshake search
Citations for BestGene :
1 - 6 of 6 citations for Human Chemokine C X C Motif Receptor 5 CXCR5 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... attP40{nos-Cas9}/CyO for the N-terminal line and y1 M{vas-Cas9.RFP-}ZH-2A w1118 (BDSC#55821) for the C-terminal line by BestGene Inc ...
-
bioRxiv - Neuroscience 2020Quote: ... Transgenic flies expressing Opto-dRET and Opto-dRETMEN2B were generated by injection of pUAST receptor constructs (BestGene). For selection ...
-
bioRxiv - Neuroscience 2023Quote: Transgenic flies harboring the FlpStop 2.0 cassette in an intron of the Ecdysone Receptor (EcR) were generated via standard construct injection (∼50ng plasmid) by Bestgene (Chino Hills, CA, USA). The MiMIC strain152 used for injection was y[1] w[*] ...
-
bioRxiv - Neuroscience 2021Quote: ... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
bioRxiv - Cell Biology 2020Quote: ... Transgenes were sequenced and then injected into embryos containing an attP8 site on the X chromosome (BDSC stock #32233, BestGene).
-
bioRxiv - Developmental Biology 2024Quote: ... We also generated additional fly lines in which the entire Ds-ICD was substituted with the ICD from human DCHS1 using microinjection services from BestGene. ds alleles were recombined with FRT40A for mitotic recombination ...