Labshake search
Citations for BestGene :
1 - 31 of 31 citations for Flumoxef sodium impurity P since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... P{CaryP}attP40 (BestGene Inc.) contains a second chromosome attP site (25C6 ...
-
bioRxiv - Cell Biology 2021Quote: ... P{CaryP}attP2 by BestGene Inc.
-
bioRxiv - Developmental Biology 2021Quote: ... P{CaryP}attP40 embryos (BestGene Inc.).
-
bioRxiv - Developmental Biology 2021Quote: ... The DNA was injected into strains P[CaryP]attP2 68A4 and P[CaryP]attP40 25C6 by BestGene Inc California [119] ...
-
bioRxiv - Neuroscience 2020Quote: ... y1w67c23;P{CaryP}attP1 (BestGene BL#8621).
-
bioRxiv - Biochemistry 2021Quote: ... P{CaryP}attP2 (BL8622) were performed by BestGene Inc ...
-
bioRxiv - Cell Biology 2021Quote: ... and was injected into P{CaryP}attP2 (BestGene Inc.).
-
bioRxiv - Genetics 2020Quote: ... P[attP,y+,w3’]VIE-260B embryos by Bestgene Inc (Chino Hills ...
-
bioRxiv - Molecular Biology 2024Quote: ... pCasper5-ph-p-mCherry plasmid containing the copia promoter and P-element transposons was injected in embryos of w1118 flies by Bestgene (Chino Hills, CA, USA). To induce knockdown of either CtIP or dUtx ...
-
bioRxiv - Cell Biology 2022Quote: ... Transgenic Flies were generated using standard P-element transformation methods (Bestgene). The following stocks were used ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... P{CaryP}attP40 for Sfla Or67b2 (BestGene Inc., Houston, Texas, USA). Transformants were selected from individually injected flies with compound eye color rescue phenotypes.
-
bioRxiv - Developmental Biology 2022Quote: ... Transgenic flies were generated using standard P-element transformation (BestGene; Chino Hills, CA).
-
bioRxiv - Genetics 2022Quote: ... Plasmid p(UASp-Kdm3-EGFP) was then injected into w1118 embryos by BestGene Inc ...
-
bioRxiv - Neuroscience 2022Quote: ... P[CaryP]attP2 (BI #8622) by injection and phiC31 integration (BestGene Inc, USA). The tubulin-gal4 and MHC-Gal4 line were generously provided by Dr ...
-
bioRxiv - Molecular Biology 2021Quote: ... P{y[+t7.7] w[+mC]=UAS-miRFP2-T2A-HO1} attP40 were generated by Bestgene using the user provided 20XUAS-IVS plasmids described above ...
-
bioRxiv - Genetics 2021Quote: ... Transgenic lines were generated using standard methods for P-element-mediated germline transformation (BestGene Inc).
-
bioRxiv - Cell Biology 2020Quote: ... The destination vectors were subsequently injected into Drosophila embryos for P-element mediated transformation (BestGene). Note that the pUWG destination vector allowed the expression of wild type dTBCE under the control of the poly-ubiquitin promoter ...
-
bioRxiv - Developmental Biology 2023Quote: ... The single donor plasmids were sent for standard P-element-mediated transformation performed by BestGene (Chino Hills, CA).
-
bioRxiv - Developmental Biology 2023Quote: The Robo3gRNA plasmid was co-injected with each homologous donor plasmid (Robo3Robo3ΔIg1, Robo3robo1ΔIg1, Robo3Robo3NPLP, Robo3Robo3mR3Ig1, Robo3Robo3FraIg1)into nos-Cas9.P embryos (Port et al., 2014) by BestGene Inc (Chino Hills ...
-
bioRxiv - Molecular Biology 2024Quote: ... Embryo injection and generation of new DR-white and ph-p-mCherry fly lines were performed by BestGene, Inc ...
-
bioRxiv - Neuroscience 2020Quote: ... selection of P-element and Phi31C transformants and selection of CRISPR/Cas9 knockouts (see below) was performed by BestGene Inc. ...
-
bioRxiv - Genetics 2020Quote: ... pUAST vectors carrying the respective inserts were used to generate transgenic lines by standard p-element insertion (BestGene, CA).
-
bioRxiv - Genetics 2023Quote: ... These 3 constructs were recombined into the attP landing site on chromosome 3L in BDSC stock #8622 (y1 w67c23; P{y+t7.7=CaryP}attP2) by BestGene, Inc.
-
bioRxiv - Developmental Biology 2022Quote: ... Transgenes were made by PhiC-mediated Recombinase Mediated Cassette Exchange (RMCE) into the P{attP.w[+].attP}JB38F docking site (BDSC #27388) by BestGene Inc.
-
bioRxiv - Cell Biology 2022Quote: ... flies carrying an ectopic copy of the CAP-H2 gene and regulatory regions were produced by random P-element integration (Bestgene). Cap-H2 genomic region was amplified using 5’ GCATGAGCGGCCGCGGCGAA TCACTCACGATAGTG 3’ and reverse 5’ GCATGAGGTACCCACAAGA ACATGTGGGAGCTC 3 primers ...
-
bioRxiv - Developmental Biology 2021Quote: The robo2 gRNA plasmid was co-injected with the robo2robo2 or robo2robo2ΔIg1 homologous donor plasmids into nos-Cas9.P embryos (Bloomington Drosophila Stock Center stock #54591) (Port et al. 2014) by BestGene Inc (Chino Hills ...
-
bioRxiv - Developmental Biology 2022Quote: ... The robo2 gRNA plasmid and homologous donor plasmid were co-injected into nos-Cas9.P embryos (Bloomington Drosophila Stock Center stock #54591) (Port et al. 2014) by BestGene Inc (Chino Hills ...
-
bioRxiv - Microbiology 2023Quote: ... Other original UAS transgenic lines listed below were generated using germline transformation by P-element based plasmid vectors (BestGene Inc.): UASp-Spaid.C290A-EGFP ...
-
bioRxiv - Developmental Biology 2023Quote: ... Embryo injection to introduce the transgene into the 2nd-chromosome through P element-mediated transformation was carried out by BestGene Inc.
-
bioRxiv - Genomics 2024Quote: ... and the UAS-H4-GFP construct [Ahmad & Henikoff 2002] was injected into fly embryos for P element transformation [Rubin & Spradling 1982] by BestGene Inc ...
-
bioRxiv - Developmental Biology 2022Quote: UAS-Lgr4 transgenic flies were generated by injection of the pUASt-Lgr4 construct 19 in w1118 embryos following standard P-element-mediated transformation procedures (BestGene, InC).