Labshake search
Citations for BestGene :
1 - 16 of 16 citations for 7H Pyrazolo 4 3 d pyrimidin 7 one 1 4 dihydro 3 b D ribofuranosyl oxime monohydrochloride 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
bioRxiv - Cell Biology 2023Quote: ... The DNA plasmid of pScarlessHD-5’ msps homology arm-C-3xVHH05-6XMS2-DsRed-3’ msps homology arm was co-injected with pCFD5-gRNA#1 and pCFD5-gRNA#2 by BestGene. Flies with fluorescent red eyes were selected and crossed with Tub-PBac flies to remove the DsRed region by PBac transposase ...
-
bioRxiv - Cell Biology 2019Quote: The optimal sgRNA in pCFD3: U6:3-gRNA vector was microinjected into embryos (BestGene, Inc) to create a transgenic fly constitutively expressing the Rpl13a-specific sgRNA ...
-
bioRxiv - Neuroscience 2019Quote: ... Transgenic flies with site-specific insertions at VK0005 site on chromosome 3 were generated using standard microinjection (BestGene, Inc.).
-
bioRxiv - Cell Biology 2019Quote: ... UASp-CFP-Msps plasmid was injected into embryos for targeted insertion on chromosome 3 at ZH-96E by Bestgene, Inc.
-
bioRxiv - Neuroscience 2021Quote: ... Transgenic flies were generated via standard procedures and φc31-mediated transposition into the Drosophila genome at the VK00027 landing site located on chromosome 3 (BestGene Inc.). To select larvae of the correct genotype for immunhistochemistry and behavior assays ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... UAS-HA-YTHDF and UAS-HA-YTHDF-3A (described above) were injected into w[1118] with Δ2-3 helper plasmid to obtain transformants (Bestgene, Inc.) Flies were raised on standard cornmeal-based food medium containing 1.25% w/v agar ...
-
bioRxiv - Neuroscience 2023Quote: ... 4 transgenic lines were identified through the loss of y and were PCR-tested for orientation of insertion by Bestgene. We then tested these lines for expression of TdTomato and gene disruption after conditional expression of FLP Recombinase (Figure S3A-D) ...
-
bioRxiv - Developmental Biology 2021Quote: ... These transgenes were integrated at ZH-86Fb site on chromosome 3 using φC31-mediated integration (Bischof and Basler, 2008) (BestGene, Chino Hills, CA). Worniu-Gal4 ...
-
bioRxiv - Developmental Biology 2021Quote: ... The various transgenic reporters were integrated into the VK31 site on chromosome 3 using φC31-mediated integration (Bischof and Basler, 2008) (BestGene, Chino Hills, CA).
-
bioRxiv - Neuroscience 2019Quote: ... and the resulting hs-svr1A-2-3-t2 construct was introduced into the germline of w1118 flies by BestGene (Chino Hills, CA, USA) using standard P-element transformation ...
-
bioRxiv - Developmental Biology 2022Quote: ... These transgenes were integrated at ZH-86Fb site on chromosome 3 using φC31-mediated integration (Bischof and Basler 2008) (BestGene, Chino Hills, CA). The Wor-Gal4 ...
-
bioRxiv - Cell Biology 2019Quote: ... P[acman]M-6-attB-UAS-1-3-4 constructs were integrated into PBac{yellow[+]-attP-3B}VK00031 (Bloomington line #9748) via PhiC31 mediated recombination (outsourced to Bestgene Inc.).
-
bioRxiv - Developmental Biology 2022Quote: ... The donor vector and gRNA plasmid (pCFD5-4) were co-injected into vas-Cas9 embryos (BL-55821; BestGene Inc, Chino Hills, CA) and the single RFP+ line obtained was balanced ...
-
bioRxiv - Cell Biology 2023Quote: ... Wild-type and deletion mutant plasmid constructs for Drosophila Calpain A and Calpain B were synthesized and sub-cloned in the pUASTattb vector to generate transgenic Drosophila lines from BestGene.
-
bioRxiv - Neuroscience 2022Quote: ... and donor vector (400 ng μl-1) into {Act5C-Cas9.P.RFP-}ZH-2A w[118] Lig[169]flies was performed by BestGene Inc ...