Labshake search
Citations for BestGene :
1 - 7 of 7 citations for 6 Amino 5 2 2 diethoxyethyl 4 hydroxy Pyrimidine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... The DNA plasmid of pScarlessHD-5’ msps homology arm-C-3xVHH05-6XMS2-DsRed-3’ msps homology arm was co-injected with pCFD5-gRNA#1 and pCFD5-gRNA#2 by BestGene. Flies with fluorescent red eyes were selected and crossed with Tub-PBac flies to remove the DsRed region by PBac transposase ...
-
bioRxiv - Developmental Biology 2021Quote: ... The various transgenic reporters were integrated into the VK37 site on chromosome 2 using φC31-mediated integration (Bischof and Basler, 2008) (BestGene, Chino Hills, CA). L3 brains from reporter fly lines were dissected ...
-
bioRxiv - Neuroscience 2019Quote: ... and the resulting hs-svr1A-2-3-t2 construct was introduced into the germline of w1118 flies by BestGene (Chino Hills, CA, USA) using standard P-element transformation ...
-
bioRxiv - Neuroscience 2021Quote: ... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
bioRxiv - Neuroscience 2023Quote: ... 4 transgenic lines were identified through the loss of y and were PCR-tested for orientation of insertion by Bestgene. We then tested these lines for expression of TdTomato and gene disruption after conditional expression of FLP Recombinase (Figure S3A-D) ...
-
bioRxiv - Cell Biology 2019Quote: ... P[acman]M-6-attB-UAS-1-3-4 constructs were integrated into PBac{yellow[+]-attP-3B}VK00031 (Bloomington line #9748) via PhiC31 mediated recombination (outsourced to Bestgene Inc.).
-
bioRxiv - Developmental Biology 2022Quote: ... The donor vector and gRNA plasmid (pCFD5-4) were co-injected into vas-Cas9 embryos (BL-55821; BestGene Inc, Chino Hills, CA) and the single RFP+ line obtained was balanced ...