Labshake search
Citations for BestGene :
1 - 4 of 4 citations for 26S Proteasome Non ATPase Regulatory Subunit 11 PSMD11 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... A mixture of both plasmids was injected into flies expressing Cas9 under nos regulatory sequences by BestGene. CRISPR edited lines were identified by the presence of DsRed eye fluorescence ...
-
bioRxiv - Cell Biology 2022Quote: ... A mixture of both plasmids was injected into flies expressing Cas9 under nos regulatory sequences (#54591; BDSC) by BestGene. CRISPR edited lines were identified by the presence of DsRed eye fluorescence and the DsRed marker was removed by crossing to flies expressing cre recombinase (#1092 ...
-
bioRxiv - Cell Biology 2022Quote: ... flies carrying an ectopic copy of the CAP-H2 gene and regulatory regions were produced by random P-element integration (Bestgene). Cap-H2 genomic region was amplified using 5’ GCATGAGCGGCCGCGGCGAA TCACTCACGATAGTG 3’ and reverse 5’ GCATGAGGTACCCACAAGA ACATGTGGGAGCTC 3 primers ...
-
bioRxiv - Molecular Biology 2019Quote: ... 11 and Vig2 transgenes were generated by standard phiC31 integrase-mediated transgenesis (Bestgene Inc.). Gmr-Gal4 was used to express transgenes and/or induce RNAi by long hairpins in retina ...