Labshake search
Citations for Eppendorf :
351 - 400 of 642 citations for 5 2 Chloronicotinoyl 2 furoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... in 0.3% acetic acid was added to a 96-well plate (CAT# 0030128664, Eppendorf, Hamburg, Germany), sealed with plate seal (CAT# 5010-21951 ...
-
bioRxiv - Genomics 2021Quote: ... Nuclei were rotated at 4 °C for 5 minutes before being pelleted again with a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). After centrifugation ...
-
bioRxiv - Genomics 2021Quote: ... nuclei were rotated at 4 °C for 5 minutes before being pelleted again with a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). After centrifugation ...
-
bioRxiv - Microbiology 2023Quote: ... vortexed for 5 min and then centrifuged (Eppendorf Centrifuge model 5810 R ...
-
bioRxiv - Microbiology 2023Quote: ... centrifuging for 5 min at 7,500 rcf (Eppendorf, tabletop centrifuge MiniSpin plus with rotor F-45-12-11) ...
-
bioRxiv - Cell Biology 2024Quote: ... was loaded with 10 μM of filtered folic acid solution and then connected to a FemtoJet microinjector (Eppendorf). The microinjector was operated in continuous injection mode with a compensation pressure of 15 hPa ...
-
bioRxiv - Cell Biology 2020Quote: ... 5000 rpm for 5 min in 5415D centrifuge (Eppendorf) to remove aggregates.
-
bioRxiv - Genomics 2022Quote: ... typically a 5 mL Lo-bind tube (0030122348, Eppendorf) or 15 mL falcon tube (229410 ...
-
bioRxiv - Neuroscience 2024Quote: ... Samples were pooled in 5 mL LoBind tubes (Eppendorf) in 1 mL chilled lysis buffer (10 mM Tris-HCl ...
-
bioRxiv - Bioengineering 2024Quote: ... centrifuged at 1200 RPM for 5 minutes (Eppendorf 5180) and stained for cell viability using Fixable Live/Dead Blue for 30 min at 4°C ...
-
bioRxiv - Systems Biology 2020Quote: ... Samples were eluted with 60 μL of buffer B (80% ACN, 0.1% formic acid in H20) and reduced in a Vacufuge plus (Eppendorf) to a final volume of 3 μL ...
-
bioRxiv - Microbiology 2024Quote: ... coli cultures and mixed with resuspended in a 1X lysis buffer / Hot Acid Phenol solution in a 1.5 mL microcentrifuge tube on a thermomixer (Eppendorf) set to 65°C ...
-
bioRxiv - Microbiology 2023Quote: ... 0.1% trifluoroacetic acid (TFA) (v/v) and the extracts were reduced to dryness using a centrifugal vacuum concentrator (Eppendorf) and re-suspended in 3 % (v/v ...
-
bioRxiv - Cell Biology 2023Quote: Peptides were eluted from home-made StageTips using 60% acetonitrile and 0.1% formic acid and evaporated to complete dryness using a SpeedVac (Eppendorf). Peptides were reconstituted in 2% formic acid and 2% acetonitrile ...
-
bioRxiv - Genomics 2023Quote: ... eluted with 2 x 100 μl of 70 % (v/v) acetonitrile in 0.5 % (v/v) trifluoroacetic acid into low-binding microcentrifugation tubes (Protein LoBind, Eppendorf), and vacuum-dried in Vacufuge Concentrator Plus (Eppendorf) ...
-
bioRxiv - Zoology 2024Quote: ... dried tissue samples were covered with 0.1 µL 2,5- Dihydroxybenzoic acid solution applied with a 0.1–2.5 µL pipette (Eppendorf AB, Hamburg, Germany). For extract analysis ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tissue homogenates were transferred to 5 mL centrifuge tubes (Eppendorf) and supplemented with 20 U benzonase and 10 U avidin prior to incubating with rotation at 4 °C for 20 min and subsequent removal of debris by centrifugation at 16,000 × g for 15 min.
-
bioRxiv - Cancer Biology 2021Quote: ... at 37°C in a humidified 5% CO2 incubator (Eppendorf). Stable cell lines overexpressing Api5 was prepared using lentiviral-mediated transduction ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tissue powder was weighed (5-20mg in precooled Eppendorf tubes), and tissues were extracted by vortexing in 40x volumes precooled acetonitrile-methanol-water (40%/40%/20% v/v/v) ...
-
bioRxiv - Cell Biology 2020Quote: ... for 5 min at room temperature (Eppendorf Centrifuge 5427 R). Columns were washed with 65 µl elution buffer (5% ammonia solution in water) ...
-
An apical protein, Pcr2, is required for persistent movement by the human parasite Toxoplasma gondiibioRxiv - Cell Biology 2022Quote: ... and centrifuged for 5 min at 2,000rpm (Eppendorf Centrifuge 5415D) to separate the secreted fraction (supernatant ...
-
bioRxiv - Cell Biology 2022Quote: ... in a 37°C humidified incubator with 5% CO2 (Eppendorf).
-
bioRxiv - Cell Biology 2023Quote: ... in a 5% CO2 containing humidified incubator (Eppendorf Galaxy 170S) at 37°C.
-
bioRxiv - Microbiology 2024Quote: ... and harvested by centrifugation (Eppendorf 5417, 20,817 g, 5 min). The cell pellet was then resuspended with equal volumes (1 ml ...
-
bioRxiv - Microbiology 2024Quote: ... kidneys and spleens were homogenized in 5 mL tubes (Eppendorf) containing 500uL of 3.2mm stainless steel beads (Next Advance ...
-
bioRxiv - Immunology 2024Quote: ... samples were microcentrifuged at 12,000g for 5 min (Eppendorf 5415C), supernatant aspirated and discarded ...
-
bioRxiv - Biophysics 2024Quote: ... 50 mM NaCl in 5 ml Protein LoBind tubes (Eppendorf). For refolding ...
-
bioRxiv - Biophysics 2024Quote: ... at 90°C for 5 minutes (Thermomixer C, Eppendorf, MA). The samples were loaded onto a 4-20% Mini-PROTEAN precast protein gel (Bio-Rad ...
-
bioRxiv - Biochemistry 2021Quote: ... The reactions were stopped by the addition of phosphoric acid and 4 µl of each reaction were spotted on P81 phosphocellulose papers (Whatman) using the epMotion 5070 (Eppendorf) workstation ...
-
bioRxiv - Neuroscience 2020Quote: We transferred 5 dpf larvae to 1.5 ml centrifuge tubes (Eppendorf). All fish water was aspirated and replaced with 1.0 ml 4% paraformaldehyde (Electron Microscopy Sciences ...
-
bioRxiv - Physiology 2020Quote: ... 1% Antibiotic-Antimycotic] in a 5% CO2 incubator (Galaxy 170R, Eppendorf) at 37°C ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... volume was reduced to 5 μL in a Speedvac concentrator (Eppendorf) and sequencing libraries were prepared using the TruSeq Small RNA Library Prep Kit (Illumina) ...
-
bioRxiv - Bioengineering 2021Quote: ... dissected brains were placed in 5 ml tubes (Eppendorf, 0030 119.401) and covered with 4.5 mL of clearing solution ...
-
bioRxiv - Microbiology 2024Quote: ... The samples were centrifuged at 272g for 5 minutes (Eppendorf 5810R) at 4°C ...
-
bioRxiv - Developmental Biology 2024Quote: ... for 5 min at 37 °C under agitation (Eppendorf, ThermoMixer C). Lobes were pipetted to promote dissociation ...
-
bioRxiv - Biophysics 2023Quote: ... and applied 1,700 V for about 5 ms (Eppendorf Eporator, 4309000027). We quickly washed the cuvette with 500 μl SOC growth medium twice and cells were allowed to recover at 37 °C for 1 hour in a 50 ml conical tube (Corning ...
-
bioRxiv - Bioengineering 2023Quote: ... and centrifuged at 8000 rpm for 5 min (Centrifuge 5430, Eppendorf), where the dissociated monomers or oligomers were separated and mainly located in the supernatant ...
-
bioRxiv - Plant Biology 2024Quote: ... The seedlings were first placed in 5 mL tubes (Eppendorf #0030119460) and snap frozen in liquid nitrogen.
-
bioRxiv - Cell Biology 2024Quote: Cell culture maintenance incubator (37 °C, 5% CO2, humidified; Eppendorf CellXpert)
-
bioRxiv - Plant Biology 2023Quote: ... The beads were then washed with 3 x 100µL of the lactic acid binding solution and finally resuspended in 50µL and placed into 200 µL tips (Eppendorf, Hauppauge, NY) plugged with 2 layers of 3M™ C8 Empore™ membrane (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... 100 µl of formic acid 1% were placed in each Millipore Microcon 30 MRCFOR030 Ultracel PL-30 before centrifugation at 14,500 rpm (Eppendorf 5424 centrifuge) for 15 minutes ...
-
bioRxiv - Cell Biology 2022Quote: Samples were incubated on a rotator for 5 min at 4°C and then centrifuged at 500g for 5 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3). Supernatant was removed and pellet was resuspended in sort buffer [1mM EDTA (Invitrogen ...
-
bioRxiv - Biophysics 2021Quote: HEK-293T cells were cultured at 37 °C and 5% CO2 (Eppendorf). Cells were plated in 60 mm dishes and transfected with 1 ug of GFP-TAX4 and 3 ug of PEI-MAX per dish ...
-
bioRxiv - Neuroscience 2020Quote: ... Male heads were incubated for 5 min on a ThermoMixer (Eppendorf 5382000023), and 25 min in a rotating hybridization oven ...
-
bioRxiv - Molecular Biology 2022Quote: ... The beads were then transferred to a 5 mL centrifuge tube (Eppendorf) and filled up completely with TEV buffer ...
-
Proteome Profiling of Cerebrospinal Fluid Reveals Novel Biomarker Candidates for Parkinson’s DiseasebioRxiv - Systems Biology 2021Quote: ... samples were shaken for 5 min at 2,000 rpm (thermomixer C, Eppendorf). Peptide concentrations were measured optically at 280nm (Nanodrop 2000 ...
-
bioRxiv - Developmental Biology 2024Quote: ... All cell centrifugations were done at 1800 rpm for 5 minutes (Eppendorf). Cells were resuspended in 200 µL of cold PBS and then 1 mL of 4% PFA was added then incubated ...
-
bioRxiv - Microbiology 2023Quote: ... and incubated for 5 min at 70 °C in ThermoMixer® (Eppendorf).
-
bioRxiv - Molecular Biology 2023Quote: ... The beads were then transferred to a 5 mL centrifuge tube (Eppendorf) and filled up completely with TEV buffer B ...